Acyrtus artius

Briggs, 1955 · species

image placeholder — illustration coming later

Animalia/Chordata/Gobiesociformes/Gobiesocidae/Acyrtus

At a glance

Occurrence records184

Data sources8

Biological traits4

DNA specimens24

eDNA detections24

Sources8 archives

Databases and archives Acyrtus artius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

OBISOcean Biodiversity Information System100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS184 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

Acyrtus artius is een straalvinnige vissensoort uit de familie van schildvissen (Gobiesocidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1955 door Briggs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length3 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability10

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acyrtus artius has left across the world's sequence archives.

At a glance

DNA specimens24

BINs4

Marker genes2

eDNA detections24

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 81 variable positions, in barcode order

15Cmostly conserved

24Amostly conserved

66Cmostly conserved

84Amostly conserved

132Cmostly conserved

135Cmostly conserved

141Cmostly conserved

144Gmostly conserved

156Tvariable

159Amostly conserved

160Cmostly conserved

162Gvariable

165Cvariable

168Tmostly conserved

169Cvariable

177Tmostly conserved

180Gvariable

201Cmostly conserved

210Tmostly conserved

229Cmostly conserved

231Gvariable

237Tmostly conserved

243Tvariable

246Cmostly conserved

249Cvariable

252Tmostly conserved

253Tmostly conserved

255Amostly conserved

273Amostly conserved

282Gvariable

291Cmostly conserved

300Cmostly conserved

303Cmostly conserved

312Cmostly conserved

321Cmostly conserved

322Tmostly conserved

324Amostly conserved

336Tmostly conserved

339Cvariable

351Gvariable

357Tvariable

360Tvariable

363Cmostly conserved

366Tmostly conserved

375Cmostly conserved

381Gmostly conserved

396Avariable

411Tvariable

414Cmostly conserved

420Tmostly conserved

423Tmostly conserved

435Tmostly conserved

441Cmostly conserved

444Cvariable

450Amostly conserved

462Cmostly conserved

463Cmostly conserved

474Amostly conserved

477Amostly conserved

498Tmostly conserved

504Gmostly conserved

507Cmostly conserved

510Cmostly conserved

513Gmostly conserved

519Gmostly conserved

522Amostly conserved

537Amostly conserved

540Amostly conserved

546Tvariable

552Cmostly conserved

555Gmostly conserved

570Tmostly conserved

573Cmostly conserved

579Cmostly conserved

582Tmostly conserved

585Tmostly conserved

588Gmostly conserved

591Cvariable

594Amostly conserved

606Cmostly conserved

609Cvariable

GTAGGCACAGCCCTCAGCCTTTTAATCCGGGCCGAACTTAGCCAGCCCGGGGCTTTACTTGGTGACGACCAAATTTATAATGTAATTGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes17

BINs4

Most divergent pair10.5%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acyrtus pauciradiatussame genus7.2%Acyrtus lanthanumsame genus9.2%Acyrtus rubiginosussame genus14.9%Arcos rhodospilussame family14.9%Neocyttus psilorhynchussame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type184 records

Wild obs. + sensor16

Museum / vouchered168

Range

Area of Occupancy AOO288 km²

Depth

0–200 m sunlit18

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10.8 m · max 28 m · 18 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 8>10 km 1

9 georeferenced · 7 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤1 km 8≤10 km 20>10 km 1

29 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence168

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	24
Chicago, US	24
Washington, US	18
Toronto, CA	5
Tapachula, MX	3
CASlocation not on record	2
Cambridge, US	1
University of California San Diegolocation not on record	1

8 institutions · 78 of 168 vouchered records shown

09Environmental DNA24 detections

Where the DNA of Acyrtus artius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 24.8–27.2

Seasonal swing summer↔winter2.90 °C

Max temp (day)27.8 °C 25.7–27.8

Min temp (night)26.5 °C 24.0–26.6

Precipitation133 mm/mo 130–351

Air humidity64.4 % 62.9–64.5

Vapour deficit1,280 Pa 1,155–1,281

Cloud cover18.8 % 18.6–27.5

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)