Acyrtops beryllinus

(Hildebrand & Ginsburg, 1927) · species

image placeholder — illustration coming later

Animalia/Chordata/Gobiesociformes/Gobiesocidae/Acyrtops

At a glance

Occurrence records323

Data sources8

Biological traits5

DNA specimens5

eDNA detections0

Sources8 archives

Databases and archives Acyrtops beryllinus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

OBISOcean Biodiversity Information System123 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS323 records

DNA & barcodingBOLD5 specimens

01Narrative

Acyrtops beryllinus is een straalvinnige vissensoort uit de familie van schildvissen (Gobiesocidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1927 door Hildebrand & Ginsburg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length2.5 cm

Life cycle & reproduction1

Max. longevity12 months

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acyrtops beryllinus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.49%

Haplotypes2

BIN1

Most divergent pair0.49%

Where individuals differ — all 7 variable positions, in barcode order

207Avariable

267Amostly conserved

306Gmostly conserved

375Gmostly conserved

396Gmostly conserved

429Amostly conserved

531Tmostly conserved

GTGGGTACCGCCCTTAGTTTACTAATTCGGGCAGAACTCAGCCAACCGGGAGCTCTCCTAGGTGATGATCAGATTTACAATGTAATCGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Microspathodon dorsalissame order17.5%Gobioclinus gobiosame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type323 records

Wild obs. + sensor74

Museum / vouchered247

Other2

Origin

Native20

Range

Area of Occupancy AOO368 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 30 m · max 30 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 10≤1 km 2>10 km 6

18 georeferenced · 56 without coordinates

Open the mapobservation + sensor74

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 50≤1 km 13≤10 km 16

79 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	76
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	35
Texas Cooperative Wildlife Collectionlocation not on record	16
UNICAMPlocation not on record	7
Los Angeles, US	4
CASlocation not on record	3
UFESlocation not on record	2
Washington, US	2
Mexico City, MX	1
Morelia, MX	1

10 institutions · 147 of 247 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)