Acyrtops amplicirrus

Briggs, 1955 · species

image placeholder — illustration coming later

Animalia/Chordata/Gobiesociformes/Gobiesocidae/Acyrtops

At a glance

Occurrence records79

Data sources8

Biological traits4

DNA specimens37

eDNA detections43

Sources8 archives

Databases and archives Acyrtops amplicirrus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

OBISOcean Biodiversity Information System22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS79 records

Environmental DNA1 datasets · 3 countries43 detections

DNA & barcodingBOLD37 specimens

01Narrative

Acyrtops amplicirrus is een straalvinnige vissensoort uit de familie van schildvissen (Gobiesocidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1955 door Briggs. De soort staat op de Rode Lijst van de IUCN als niet bedreigd, beoordelingsjaar 2009.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length1.86 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acyrtops amplicirrus has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections43

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

223Cmostly conserved

301Amostly conserved

313Amostly conserved

340Gmostly conserved

625Amostly conserved

CCTCTACCTAGTATTTGGTGCATGAGCGGGGATAGTGGGTACCGCCCTTAGCTTACTAATTCGGGCAGAACTCAGCCAACCGGGAGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes19

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Microspathodon dorsalissame order17.2%Gobioclinus gobiosame order17.7%Kuhlia marginatasame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type79 records

Wild obs. + sensor9

Museum / vouchered66

Other4

Origin

Native1

Range

Area of Occupancy AOO92 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.4 m · max 1.5 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 6

8 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	35
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Chicago, US	3
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	2
Mexico City, MX	2
Toronto, CA	2
Texas Cooperative Wildlife Collectionlocation not on record	1

7 institutions · 49 of 66 vouchered records shown

09Environmental DNA43 detections

Where the DNA of Acyrtops amplicirrus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 24.9–27.5

Seasonal swing summer↔winter3.00 °C

Max temp (day)26.1 °C 25.9–28.2

Min temp (night)24.9 °C 24.0–26.6

Precipitation40.5 mm/mo 40.5–154

Air humidity61.4 % 60.0–63.9

Moisture balance-138 mm/mo

Vapour deficit1,249 Pa 1,240–1,315

Wind speed4.30 m/s

Cloud cover25.5 % 20.0–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)