Acyrthosiphon gossypii

Mordvilko, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Acyrthosiphon

At a glance

Occurrence records8

Data sources5

Biological traits0

DNA specimens30

eDNA detections33

Sources5 archives

Databases and archives Acyrthosiphon gossypii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 1 countries33 detections

DNA & barcodingBOLD30 specimens

01Narrative

Acyrthosiphon gossypii, the melon aphid or cotton aphid, is an aphid in the superfamily Aphidoidea in the order Hemiptera. It is a true bug and sucks sap from plants. It is found from India, Sri Lanka, Cameroon, and South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acyrthosiphon gossypii has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

189Tmostly conserved

259Amostly conserved

504Amostly conserved

647Amostly conserved

TTATACTTTTTATTTGGTATCTGATCAGGTATAATTGGATCATCTTTAAGAATTTTAATTCGTTTAGAATTAAGACAAATTAATTCTATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acyrthosiphon assiniboinensesame genus5.1%Acyrthosiphon kondoisame genus5.4%Corylobium avellanaesame family5.5%Impatientinum asiaticumsame family5.5%Acyrthosiphon churchillensesame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence8

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	6
South Kensington, GB	1

2 institutions · 7 of 8 vouchered records shown · 1 without an institution code

09Environmental DNA33 detections

Where the DNA of Acyrthosiphon gossypii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 17.1–25.2

Seasonal swing summer↔winter21.9 °C

Max temp (day)26.5 °C 21.5–30.2

Min temp (night)14.1 °C 10.0–18.1

Precipitation19.7 mm/mo 13.6–44.2

Air humidity41.6 % 31.7–50.5

Moisture balance-151 mm/mo -189–-84.4

Vapour deficit1,776 Pa 1,173–1,869

Wind speed3.50 m/s 2.30–4.60

Cloud cover23.9 % 8.90–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)