Acutalis tartarea

Say · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Membracidae/Acutalis

At a glance

Occurrence records1 921

Data sources5

Biological traits0

DNA specimens38

eDNA detections1

Sources5 archives

Databases and archives Acutalis tartarea's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 921 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 921 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD38 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acutalis tartarea has left across the world's sequence archives.

At a glance

DNA specimens38

BINs4

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 104 variable positions, in barcode order

10Cmostly conserved

22Amostly conserved

25Gmostly conserved

31Tmostly conserved

43Amostly conserved

46Avariable

58Amostly conserved

64Tvariable

67Amostly conserved

68Amostly conserved

76Amostly conserved

79Amostly conserved

82Amostly conserved

94Tmostly conserved

95Cmostly conserved

97Amostly conserved

100Tmostly conserved

110Gmostly conserved

115Tmostly conserved

142Tmostly conserved

145Tmostly conserved

160Amostly conserved

163Tmostly conserved

172Cmostly conserved

181Amostly conserved

184Tmostly conserved

197Cvariable

208Cvariable

211Amostly conserved

214Tmostly conserved

220Cmostly conserved

223Tmostly conserved

226Tmostly conserved

229Gmostly conserved

235Tvariable

238Tmostly conserved

250Tmostly conserved

256Tmostly conserved

266Tmostly conserved

284Cmostly conserved

286Amostly conserved

295Gmostly conserved

301Amostly conserved

302Tmostly conserved

310Gmostly conserved

313Gvariable

316Amostly conserved

322Amostly conserved

325Gmostly conserved

334Amostly conserved

343Amostly conserved

346Cvariable

349Amostly conserved

358Cmostly conserved

359Tmostly conserved

361Amostly conserved

364Tmostly conserved

367Cmostly conserved

371Gmostly conserved

373Avariable

379Tmostly conserved

380Amostly conserved

385Amostly conserved

394Cmostly conserved

397Cmostly conserved

400Tmostly conserved

406Tmostly conserved

415Tmostly conserved

418Tmostly conserved

427Tmostly conserved

430Amostly conserved

434Tmostly conserved

451Tmostly conserved

454Tmostly conserved

466Gmostly conserved

469Tmostly conserved

473Amostly conserved

474Amostly conserved

476Cmostly conserved

478Tmostly conserved

490Cmostly conserved

493Amostly conserved

508Tmostly conserved

517Amostly conserved

526Cmostly conserved

533Cmostly conserved

542Cmostly conserved

544Tmostly conserved

547Amostly conserved

553Avariable

565Amostly conserved

578Tmostly conserved

586Tmostly conserved

589Cmostly conserved

598Tmostly conserved

601Tmostly conserved

604Cmostly conserved

607Amostly conserved

619Gmostly conserved

622Gmostly conserved

628Tmostly conserved

631Tmostly conserved

646Tmostly conserved

652Tmostly conserved

AACATTATACTTTTTATTTGGAATGTGATCTGGAATAATTGGAATAATAATAAGAATAATTATTCGAATTGAATTAGGACAACCTGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes10

BINs4

Most divergent pair11.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Grandolobus inaequalissame family16.3%Harmonides disparsame family17.6%Harmonides reticulatasame family17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 921 records

Wild obs. + sensor1 572

Museum / vouchered349

Range

Area of Occupancy AOO4 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 779≤1 km 303≤10 km 43>10 km 133

1 258 georeferenced · 314 without coordinates

Open the mapobservation + sensor1 572

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 27≤1 km 66≤10 km 73>10 km 5

171 georeferenced · 178 without coordinates

Open the institutions mapphysical evidence349

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	164
University of Central Floridalocation not on record	61
Mississippi State, US	41
Provo, US	34
University of Guelphlocation not on record	11
Espace pour la vielocation not on record	7
UDlocation not on record	7
OSUClocation not on record	5
Colorado State Universitylocation not on record	5
University Park, US	3
Lubbock, US	1
CUlocation not on record	1

12 institutions · 340 of 349 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Acutalis tartarea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acutalis tartarea

At a glance

Sources5 archives

At a glance

Record type1 921 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 921 records