Aculus schlechtendali

(Nalepa, 1890) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Eriophyidae/Aculus

At a glance

Occurrence records31

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Aculus schlechtendali's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceTreeOfSex2n = 4

01Narrative

Die Apfelrostmilbe (Aculus schlechtendali) ist eine Milbenart aus der Familie der Gall- und Rostmilben (Eriophyidae). In Deutschland tritt sie erst ab den 1980er Jahren in größerem Maße als Schädling an Apfel- und Birnbäumen in Erscheinung.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aculus schlechtendali has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes0

BIN1

Where individuals differ — all 3 variable positions, in barcode order

457Tmostly conserved

624Gvariable

635Nhighly variable

GGATGTATTTTTTTTTTGGCTTCTGAAGAGCCCTCTATGGTACTTCTCTTAGGATGGTAATGCGGTTAGAATTAGGTCAACCAGGATCTT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Aculus schlechtendali carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 4 n = 2

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 41×TreeOfSex · invert

TreeOfSex · invert — Norton, R. A., J. B. Kethley, D. E. Johnston, and B. M. O'Connor. 1993. Phylogenetic perspectives on genetic systems and reproductive modes of mites. Pp. 8-99 in D. L. Wrensch and M. A. Ebbert, Evolution and diversity of sex ratio in insects and mites, Springer. ↗

08Occurrence & distribution

Record type31 records

Wild obs. + sensor3

Museum / vouchered28

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1>10 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 28 records without

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	25
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	3

2 institutions · 28 of 28 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Aculus schlechtendali was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 20.4–20.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)25.7 °C

Min temp (night)16.1 °C

Precipitation92.0 mm/mo

Air humidity57.6 %

Moisture balance-67.9 mm/mo

Vapour deficit1,015 Pa

Wind speed3.70 m/s

Cloud cover38.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)