Aculus ligustri

(Keifer, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Eriophyidae/Aculus

At a glance

Occurrence records9

Data sources5

Biological traits0

DNA specimens8

eDNA detections15

Sources5 archives

Databases and archives Aculus ligustri's data was compiled from.

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aculus ligustri has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections15

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

85Cvariable

304Cvariable

596Cvariable

616Cmostly conserved

628Gmostly conserved

TAGTATATATTTCTTTTTCGGTTTCTGAAGAGCCCTTTATGGCACTTCTTTAAGTATAGTTATGCGTTTAGAGTTGAGTCAGCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes3

BIN1

Most divergent pair0.76%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aculops sinensissame family3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 records

Museum / vouchered9

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence9

10Collections & institutions

Institution	Specimens
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	7
Essig Museum of Entomologylocation not on record	1
Catholic University of Pekinglocation not on record	1

3 institutions · 9 of 9 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Aculus ligustri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.9. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 22.6–25.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)29.6 °C 25.8–29.6

Min temp (night)21.9 °C 18.9–21.9

Precipitation196 mm/mo 196–212

Air humidity65.1 % 65.1–65.7

Moisture balance39.3 mm/mo 39.3–69.2

Vapour deficit1,164 Pa 938–1,164

Wind speed2.70 m/s 1.90–2.70

Cloud cover33.1 % 33.1–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)