Actizera stellata

(Trimen, 1883) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Actizera

At a glance

Occurrence records256

Data sources8

Biological traits0

DNA specimens6

eDNA detections5

Sources8 archives

Databases and archives Actizera stellata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility256 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF256 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Actizera stellata, the red-clover blue, is a butterfly of the family Lycaenidae. It is found in South Africa, Ethiopia, southern Sudan, Kenya, Uganda, Zaire, Tanzania and northern Malawi. In South Africa it is found in the East Cape and the southern part of the Orange Free State. The wingspan is 13–18 mm for males and 15–19 mm for females. Adults are on wing from January to May, with a peak from January to February. There is one extended generation per year. The larvae feed on Trifolium africanum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actizera stellata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.91%

Haplotypes2

BINs2

Most divergent pair0.91%

Where individuals differ — all 13 variable positions, in barcode order

76Gvariable

103Cvariable

160Avariable

202Avariable

271Avariable

380Gmostly conserved

412Tmostly conserved

445Tmostly conserved

517Amostly conserved

530Tmostly conserved

596Tmostly conserved

613Tmostly conserved

616Tvariable

AACTTTATACTTCATTTTTGGTATTTGAGCAGGAATATTAGGAACATCATTAAGAATTTTAATTCGAATAGAATTGGGAACTCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actizera atrigemmatasame genus6.4%Callophrys poliossame family6.5%Actizera lucidasame genus6.7%Jamides soemiassame family6.8%Glaucopsyche lycormassame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type256 records

Wild obs. + sensor84

Museum / vouchered172

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 24≤1 km 14≤10 km 11>10 km 9

58 georeferenced · 26 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 18

19 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Teylers Museumlocation not on record	123
Durban Natural Science Museumlocation not on record	11
New Haven, US	10
Iziko South African Museumlocation not on record	10
Cambridge, US	8
Cape Town, ZA	3
African Butterfly Research Institutelocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

8 institutions · 167 of 172 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Actizera stellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 18.0–23.8

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.0 °C 23.1–29.8

Min temp (night)12.7 °C 12.2–17.0

Precipitation43.2 mm/mo 26.6–82.7

Air humidity52.7 % 51.9–56.7

Moisture balance-111 mm/mo -124–-95.6

Vapour deficit1,121 Pa 888–1,444

Wind speed2.40 m/s 2.20–3.70

Cloud cover23.4 % 22.7–29.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)