Actinorhytis calapparia

(Blume) H.Wendl. & Drude ex Scheff. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Actinorhytis

At a glance

Occurrence records43

Data sources7

Biological traits23

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Actinorhytis calapparia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Actinorhytis calapparia est une espèce de plantes à fleurs la famille des Arecaceae (palmiers). C'est la seule espèce validement décrite du genre Actinorhytis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length100 mm

Fruit width55 mm

Fruit width max60 mm

Fruit width min50 mm

Leaf length max4 760 mm

Plant height40 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits6

Dbh max30 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max4 000 cm

Shoot orientationerect

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinorhytis calapparia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ634506.1 ↗370 bp

ACGT

TCGAGGGCAGCCTGCCTGGGCGTCATGCAAAAATGGATTCTCCGCTCCCCCCGGGTCCGTGATGGGCTTCGGGGTGGCCGGACGCGGACA …

Actinorhytis calapparia voucher C.E. Lewis 97-011 (FTG) 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor2

Museum / vouchered36

Other5

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 2≤1 km 6≤10 km 8>10 km 1

17 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	17
Bronx, US	3
Paris, FR	3
Xiamen, CN	3
Tampa, US	2
HAWlocation not on record	1
University of Stellenboschlocation not on record	1
LDlocation not on record	1

8 institutions · 31 of 36 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Actinorhytis calapparia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 11.3–11.3

Seasonal swing summer↔winter15.8 °C

Max temp (day)15.1 °C

Min temp (night)7.30 °C

Precipitation76.5 mm/mo

Air humidity62.5 %

Moisture balance-8.00 mm/mo

Vapour deficit552 Pa

Wind speed4.60 m/s

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)