Actinodium cunninghamii

Schauer ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Actinodium

At a glance

Occurrence records76

Data sources9

Biological traits23

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Actinodium cunninghamii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Chemical compositionLOTUS34 compounds

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 12

01Narrative

Actinodium cunninghamii, commonly known as swamp daisy or Albany daisy, is the only formally described species in the genus of flowering plants in the family Myrtaceae, Actinodium and is endemic to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length3.75 mm

Leaf width0.85 mm

Plant height0.6 m

Plant height max1 m

Plant height min0.15 m

Life cycle & reproduction6

Flowering timennnnnnnyyyyn

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition34 compounds

Compounds documented for Actinodium cunninghamii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aromadendrane sesquiterpenoids8

Acyclic monoterpenoids4

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Monocyclic monoterpenoids3

Pinane monoterpenoids3

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(+)-Eudesma-5,7(11)-diene	present	LOTUS
(+)-trans-Pinocarveol	present	LOTUS
(-)-Bicycloelemene	present	LOTUS
(1aS,4aS,7aS,7bR)-1,1,7-trimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulene	present	LOTUS
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
(1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene	present	LOTUS
(2S,4R)-1,7,7-trimethylbicyclo(2.2.1)heptan-2-ol	present	LOTUS
1-Isopropyl-4-methylbenzene	present	LOTUS
1-Methoxy-4-(2-propenyl)benzene	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinodium cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAF489394.3 ↗2 491 bp

ACGT

TTACACATTTATATGAAGTAACGGATTCATTCATACCTTCGGTAGAGTTTCTAAGACCACGACTGATCCTGAAAGGAATGAATGGAAAAA …

Actinodium cunninghamii isolate s47 trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Actinodium cunninghamii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1950, 1954a

CCDB · book-atlas-flowering-plants — Smith-White 1950

n 61×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Rye, B. L. 1979. Chromosome number variation in the Myrtaceae and its taxonomic implications. Austral. J. Bot. 27: 547–573.

08Occurrence & distribution

Record type76 records

Wild obs. + sensor69

Museum / vouchered7

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 43≤1 km 9≤10 km 2>10 km 3

57 georeferenced · 12 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	2
South Kensington, GB	2
Wellington, NZ	1

3 institutions · 5 of 7 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Actinodium cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)