Actina viridis

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Stratiomyidae/Actina

At a glance

Occurrence records501

Data sources7

Biological traits0

DNA specimens72

eDNA detections70

Sources7 archives

Databases and archives Actina viridis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility501 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF501 records

Environmental DNA1 datasets · 2 countries70 detections

DNA & barcodingBOLD72 specimens

01Narrative

Actina viridis is a species of soldier fly in the family Stratiomyidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actina viridis has left across the world's sequence archives.

At a glance

DNA specimens72

BINs1

Marker genes1

eDNA detections70

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

22Gvariable

58Tmostly conserved

67Amostly conserved

70Amostly conserved

79Avariable

82Tmostly conserved

85Amostly conserved

88Amostly conserved

106Tmostly conserved

115Cmostly conserved

133Amostly conserved

181Amostly conserved

205Amostly conserved

214Cvariable

217Gmostly conserved

232Tmostly conserved

266Tmostly conserved

268Amostly conserved

316Gmostly conserved

343Cmostly conserved

346Amostly conserved

352Gmostly conserved

370Amostly conserved

373Gvariable

403Gmostly conserved

454Gvariable

460Cmostly conserved

469Amostly conserved

478Avariable

490Tmostly conserved

547Amostly conserved

574Cmostly conserved

581Tmostly conserved

601Tmostly conserved

622Amostly conserved

649Avariable

AACCCTATATTTTATTTTTGGGGCTTGAGCTGGAATAATTGGAACTTCTTTAAGAATTTTAATTCGAGCAGAATTAGGACATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes18

BIN1

Most divergent pair7.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chorisops tibialissame family10.2%Geomyza nartshukaesame order10.7%Geomyza tripunctatasame order10.7%Syndyas pleuripolitasame order11.3%Syndyas lustricolasame order11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type501 records

Wild obs. + sensor317

Museum / vouchered184

Origin

Native1

Range

Area of Occupancy AOO1 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 124≤1 km 70≤10 km 26>10 km 27

247 georeferenced · 70 without coordinates

Open the mapobservation + sensor317

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤1 km 1≤10 km 16>10 km 6

24 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence184

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	34
University of Guelphlocation not on record	23
Wuzhou, CN	22
University Park, US	20
Biodiversity Institute of Ontariolocation not on record	19
OSUClocation not on record	8
WIlocation not on record	7
McGill University, Lyman Entomological Museumlocation not on record	5
Washington, US	5
Chicago, US	1
CUlocation not on record	1
Los Angeles, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

13 institutions · 147 of 184 vouchered records shown · 37 without an institution code

09Environmental DNA70 detections

Where the DNA of Actina viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map2 countries0

Mixed habitatWetlandGrassland14. Artificial - Terrestrial|14.5 Urban AreasForest1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 12.6–17.7

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.9 °C 17.4–22.1

Min temp (night)8.00 °C 6.80–13.6

Precipitation88.1 mm/mo 80.3–106

Air humidity56.4 % 55.1–58.3

Moisture balance-37.7 mm/mo -49.7–-7.30

Vapour deficit681 Pa 627–833

Wind speed3.20 m/s 2.30–4.00

Cloud cover46.0 % 39.1–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)