Actina chalybea

Meigen, 1804 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Stratiomyidae/Actina

At a glance

Occurrence records866

Data sources7

Biological traits0

DNA specimens7

eDNA detections5

Sources7 archives

Databases and archives Actina chalybea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility866 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF866 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Actina chalybea is a species of 'soldier flies' belonging to the family Stratiomyidae subfamily Beridinae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actina chalybea has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACTTTATACTTTATTTTTGGGGCTTGAGCTGGAATAGTGGGAACTTCTCTAAGAATTTTAATTCGGGCTGAATTAGGTCACCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chorisops tibialissame family9.6%Chorisops nagatomiisame family10.8%Beris stroblisame family11.3%Iteaphila bifidasame order12.0%Beris vallatasame family12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type866 records

Wild obs. + sensor860

Museum / vouchered6

Range

Area of Occupancy AOO2 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 313≤1 km 118≤10 km 103>10 km 17

551 georeferenced · 309 without coordinates

Open the mapobservation + sensor860

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
BioFokuslocation not on record	1

3 institutions · 6 of 6 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Actina chalybea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 8.40–12.8

Seasonal swing summer↔winter19.1 °C

Max temp (day)15.4 °C 12.5–17.0

Min temp (night)5.60 °C 3.00–7.80

Precipitation73.4 mm/mo 43.7–138

Air humidity59.8 % 57.3–61.8

Moisture balance-27.6 mm/mo -40.9–39.2

Vapour deficit569 Pa 431–615

Wind speed3.20 m/s 2.70–3.40

Cloud cover38.0 % 33.5–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)