Actias sinensis

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Actias

At a glance

Occurrence records343

Data sources7

Biological traits0

DNA specimens100

eDNA detections88

Sources7 archives

Databases and archives Actias sinensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility343 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics100 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF343 records

Environmental DNA1 datasets · 3 countries88 detections

DNA & barcodingBOLD100 specimens

01Narrative

Actias sinensis, the Golden moon moth, is a moth of the Family Saturniidae. It is found in China, Taiwan, Vietnam, Myanmar, India and Thailand. The species was first described by Francis Walker in 1855.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding100 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actias sinensis has left across the world's sequence archives.

At a glance

DNA specimens100

BINs4

Marker genes1

eDNA detections88

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus93 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

40Amostly conserved

70Tmostly conserved

136Cmostly conserved

172Tmostly conserved

226Cmostly conserved

265Cmostly conserved

266Tmostly conserved

302Gmostly conserved

340Tmostly conserved

355Amostly conserved

370Cmostly conserved

415Gvariable

506Gmostly conserved

568Tmostly conserved

574Cmostly conserved

580Tmostly conserved

595Tmostly conserved

616Cmostly conserved

625Gmostly conserved

AACTTTATACTTCATTTTTGGAATTTGAGCAGGAATAGTAGGGACTTCTTTAAGTCTTCTTATTCGAGCTGAATTAGGAACTCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.86%

Haplotypes24

BINs4

Most divergent pair2.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actias parasinensissame genus4.1%Actias dianasame genus8.1%Actias maenassame genus8.7%Actias bulbosasame genus9.1%Actias timorensissame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type343 records

Wild obs. + sensor329

Museum / vouchered14

Range

Area of Occupancy AOO924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 117≤1 km 79≤10 km 35>10 km 41

272 georeferenced · 57 without coordinates

Open the mapobservation + sensor329

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 1

6 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	6
New Haven, US	2
Denver, US	2
Zürich, CH	2
Vietnam National Museum of Naturelocation not on record	1
Auckland, NZ	1

6 institutions · 14 of 14 vouchered records shown

09Environmental DNA88 detections

Where the DNA of Actias sinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 12.8–28.8

Seasonal swing summer↔winter16.7 °C

Max temp (day)26.0 °C 15.5–31.2

Min temp (night)18.5 °C 10.4–24.8

Precipitation230 mm/mo 61.1–330

Air humidity64.5 % 59.2–67.2

Moisture balance99.5 mm/mo -21.5–256

Vapour deficit1,006 Pa 554–1,396

Wind speed2.40 m/s 1.60–5.60

Cloud cover49.8 % 33.7–62.1

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)