Actias dubernardi

Oberthür, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Actias

At a glance

Occurrence records187

Data sources6

Biological traits0

DNA specimens15

eDNA detections15

Sources6 archives

Databases and archives Actias dubernardi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 3 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Actias dubernardi, the Chinese moon moth, is a moth of the family Saturniidae. The species was first described by Charles Oberthür in 1897.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actias dubernardi has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

22Amostly conserved

43Gmostly conserved

82Amostly conserved

106Cmostly conserved

154Tmostly conserved

202Tmostly conserved

265Amostly conserved

268Cmostly conserved

274Amostly conserved

439Cmostly conserved

532Cmostly conserved

562Gmostly conserved

640Tvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACTTCTTTAAGTCTTCTTATTCGAGCTGAATTAGGAACACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes5

BIN1

Most divergent pair1.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actias chapaesame genus8.7%Saturnia fukudaisame family10.2%Saturnia kitchingisame family10.3%Saturnia thibetasame family10.3%Saturnia shaanxianasame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor179

Museum / vouchered8

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 44≤1 km 33≤10 km 18>10 km 39

134 georeferenced · 45 without coordinates

Open the mapobservation + sensor179

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 3>10 km 1

5 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	3
Paris, FR	2
Natural History Museum of Utahlocation not on record	2
Zürich, CH	1

4 institutions · 8 of 8 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Actias dubernardi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 11.6–27.9

Seasonal swing summer↔winter23.9 °C

Max temp (day)26.2 °C 15.3–31.0

Min temp (night)18.4 °C 5.80–24.0

Precipitation171 mm/mo 119–236

Air humidity65.5 % 60.7–67.5

Moisture balance26.2 mm/mo -8.70–95.7

Vapour deficit935 Pa 477–1,383

Wind speed2.40 m/s 1.40–3.90

Cloud cover34.9 % 29.7–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)