Actia crassicornis

(Meigen, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Actia

At a glance

Occurrence records581

Data sources6

Biological traits0

DNA specimens36

eDNA detections65

Sources6 archives

Databases and archives Actia crassicornis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility581 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF581 records

Environmental DNA3 datasets · 11 countries65 detections

DNA & barcodingBOLD36 specimens

01Narrative

Actia crassicornis is een vliegensoort uit de familie van de sluipvliegen (Tachinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1824 door Johann Wilhelm Meigen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actia crassicornis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections65

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

233Tmostly conserved

345Cmostly conserved

644Tmostly conserved

CTTTATATTTTATTTTTGGAGCTTGATCTGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCCGAATTAGGTCATCCAGGAGCCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actia dubitatasame genus1.7%Ectophasia rotundiventrissame family9.6%Pegomya zonatasame order9.8%Pegomya tenerasame order9.8%Pegomya vittigerasame order10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type581 records

Wild obs. + sensor272

Museum / vouchered307

Other2

Range

Area of Occupancy AOO1 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 198≤1 km 56≤10 km 12

266 georeferenced · 6 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 265≤1 km 22≤10 km 4

291 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence307

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	22
NHMOlocation not on record	12
University of Tokyo, Department of Zoologylocation not on record	7
neflocation not on record	7
South Kensington, GB	5
Gothenburg, SE	4
Norwegian Institute for Nature Researchlocation not on record	3
Helsinki, FI	3
NCMGlocation not on record	3
Tampere Museum of Natural Historylocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Metsähallituslocation not on record	2
Tromsø, NO	1
Finnish Museum of Natural History, Zoological Museumlocation not on record	1
CBDClocation not on record	1

15 institutions · 76 of 307 vouchered records shown · 231 without an institution code

09Environmental DNA65 detections

Where the DNA of Actia crassicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys3

Countries11

Verifiable raw sequence linked39

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map11 countries0

1.1. Boreal Forest|1. Forest & Woodland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 7.10–17.7

Seasonal swing summer↔winter19.3 °C

Max temp (day)19.1 °C 11.7–21.8

Min temp (night)12.2 °C 2.00–13.8

Precipitation87.2 mm/mo 56.0–195

Air humidity61.1 % 58.8–63.1

Moisture balance-27.3 mm/mo -83.1–96.9

Vapour deficit697 Pa 374–828

Wind speed3.30 m/s 2.40–5.90

Cloud cover46.0 % 38.4–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 63 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)