Acteniceromorphus volitans

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Acteniceromorphus

At a glance

Occurrence records247

Data sources4

Biological traits0

DNA specimens24

eDNA detections22

Sources4 archives

Databases and archives Acteniceromorphus volitans's data was compiled from.

GBIFGlobal Biodiversity Information Facility247 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF247 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD24 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acteniceromorphus volitans has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

68Gmostly conserved

247Cmostly conserved

589Tmostly conserved

605Tmostly conserved

AACCTTATACTTTTTATTCGGAGCATGAGCAGGGATACTAGGAACCTCCCTAAGACTTCTGATCCGCGCAGAACTTGGTAACCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Liotrichus affinissame family10.5%Paractenicera fulvipessame family14.1%Eanus estriatussame family15.2%Melanotus castanipessame family16.0%Hemicrepidius coreanussame family16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type247 records

Wild obs. + sensor52

Museum / vouchered195

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 18≤1 km 15≤10 km 9>10 km 2

44 georeferenced · 8 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 151≤1 km 38≤10 km 4

193 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	192
University of Alaska Museumlocation not on record	2
AHABlocation not on record	1

3 institutions · 195 of 195 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Acteniceromorphus volitans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.1. Boreal Forestclear cutsand dunethin 2nd growthForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 8.60–13.2

Seasonal swing summer↔winter22.6 °C

Max temp (day)16.4 °C 11.4–18.7

Min temp (night)5.80 °C 3.40–8.60

Precipitation141 mm/mo 73.7–165

Air humidity58.3 % 55.1–63.6

Moisture balance17.2 mm/mo -46.7–81.2

Vapour deficit573 Pa 409–654

Wind speed2.70 m/s 2.00–4.80

Cloud cover37.9 % 36.3–43.6

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)