Actebia balanitis

Grote, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Actebia

At a glance

Occurrence records372

Data sources6

Biological traits0

DNA specimens29

eDNA detections41

Sources6 archives

Databases and archives Actebia balanitis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility372 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF372 records

Environmental DNA1 datasets · 6 countries41 detections

DNA & barcodingBOLD29 specimens

01Narrative

Actebia balanitis is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1873. It is found from north-east Alaska and western Yukon east to east central Saskatchewan and north central South Dakota, south to northern Colorado and west to central Washington and the dry interior of British Columbia. The wingspan is 36–40 mm. Adults are on wing from June to August depending on the location. There is one generation per year. This species has previously been confused with the Palearctic species Actebia squalida, which led to A. squalida to be misreported from North America. The larvae probably feed on various grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actebia balanitis has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections41

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

34Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actebia laetificasame genus3.8%Actebia violettasame genus4.0%Agrotis chretienisame family4.3%Protogygia millerisame family4.3%Protogygia polingisame family4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type372 records

Wild obs. + sensor6

Museum / vouchered366

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 3≤10 km 2>10 km 1

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 111≤1 km 20≤10 km 7>10 km 11

149 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence366

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	140
Colorado State Universitylocation not on record	119
Royal Saskatchewan Museumlocation not on record	25
New Haven, US	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
Edmonton, CA	15
Helsinki, FI	3
Vernal, US	2

8 institutions · 340 of 366 vouchered records shown · 26 without an institution code

09Environmental DNA41 detections

Where the DNA of Actebia balanitis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map6 countries0

ForestMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C -2.20–18.5

Seasonal swing summer↔winter25.5 °C

Max temp (day)20.0 °C 2.10–25.5

Min temp (night)7.60 °C -5.80–11.7

Precipitation58.1 mm/mo 28.7–75.1

Air humidity52.8 % 49.7–61.5

Moisture balance-64.8 mm/mo -85.7–19.1

Vapour deficit776 Pa 217–1,044

Wind speed2.50 m/s 1.50–4.10

Cloud cover39.7 % 32.6–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)