Actaeodes tomentosus

(H.Milne Edwards, 1834) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Xanthidae/Actaeodes

At a glance

Occurrence records826

Data sources8

Biological traits4

DNA specimens14

eDNA detections8

Sources8 archives

Databases and archives Actaeodes tomentosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility570 records↗

OBISOcean Biodiversity Information System256 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS826 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD14 specimens

01Narrative

Actaeodes tomentosus is een krabbensoort uit de familie van de Xanthidae. De wetenschappelijke naam van de soort werd in 1834 voor het eerst geldig gepubliceerd door Henri Milne-Edwards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max100 m

Depth min0 m

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actaeodes tomentosus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 74% of positions are identical in every specimen.

Where individuals differ — all 174 variable positions, in barcode order

4Cmostly conserved

16Tmostly conserved

19Tmostly conserved

22Amostly conserved

25Amostly conserved

34Tvariable

37Amostly conserved

40Amostly conserved

43Tmostly conserved

49Cmostly conserved

50Cmostly conserved

55Amostly conserved

58Amostly conserved

67Cmostly conserved

70Tmostly conserved

76Amostly conserved

77Gmostly conserved

79Amostly conserved

85Tmostly conserved

88Amostly conserved

90Cmostly conserved

97Tmostly conserved

100Amostly conserved

103Tmostly conserved

106Cmostly conserved

109Amostly conserved

115Tmostly conserved

118Tmostly conserved

121Gmostly conserved

124Amostly conserved

127Gmostly conserved

130Amostly conserved

133Tmostly conserved

136Cmostly conserved

139Cmostly conserved

142Cmostly conserved

157Tmostly conserved

166Amostly conserved

169Cmostly conserved

172Tmostly conserved

190Gmostly conserved

193Cmostly conserved

202Amostly conserved

205Amostly conserved

206Tmostly conserved

208Amostly conserved

211Gmostly conserved

212Tmostly conserved

220Cmostly conserved

223Tmostly conserved

229Amostly conserved

232Cmostly conserved

235Cmostly conserved

238Cmostly conserved

259Cmostly conserved

265Cmostly conserved

268Amostly conserved

271Tmostly conserved

274Tmostly conserved

277Tmostly conserved

280Tmostly conserved

281Amostly conserved

283Tmostly conserved

286Cmostly conserved

289Amostly conserved

292Amostly conserved

294Tmostly conserved

295Amostly conserved

299Gmostly conserved

301Amostly conserved

304Amostly conserved

307Tmostly conserved

313Cmostly conserved

316Amostly conserved

319Tmostly conserved

322Amostly conserved

325Cmostly conserved

328Amostly conserved

331Gmostly conserved

334Tmostly conserved

346Amostly conserved

347Cmostly conserved

349Tmostly conserved

352Cmostly conserved

355Tmostly conserved

361Cmostly conserved

364Cmostly conserved

367Tmostly conserved

370Tmostly conserved

376Amostly conserved

379Tmostly conserved

382Amostly conserved

386Amostly conserved

391Amostly conserved

394Cmostly conserved

400Cmostly conserved

403Tmostly conserved

407Tmostly conserved

409Gmostly conserved

412Amostly conserved

415Amostly conserved

418Tmostly conserved

421Tmostly conserved

424Tmostly conserved

427Tmostly conserved

428Tmostly conserved

436Tmostly conserved

439Amostly conserved

451Cmostly conserved

454Cmostly conserved

457Tmostly conserved

463Cmostly conserved

470Tmostly conserved

473Tmostly conserved

474Tmostly conserved

475Cmostly conserved

478Tmostly conserved

484Amostly conserved

487Amostly conserved

499Amostly conserved

+54 more variable positions not shown

TACCTTATATTTTATTTTTGGAGCATGAGCTGGTATAGTAGGTACATCCCTAAGACTAATTATTCGCGCTGAACTAGGACAACCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.7%

Haplotypes5

BIN1

Most divergent pair19.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actaeodes hirsutissimussame genus11.8%Actaeodes mutatussame genus12.2%Liagore rubromaculatasame family13.0%Pseudoliomera helleriisame family13.4%Epiactaea margaritiferasame family13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type826 records

Wild obs. + sensor141

Museum / vouchered684

Other1

Range

Area of Occupancy AOO1 288 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.5 m · max 0.6 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 35≤1 km 21≤10 km 4>10 km 16

76 georeferenced · 65 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 27≤1 km 154≤10 km 90>10 km 36

307 georeferenced · 377 without coordinates

Open the institutions mapphysical evidence684

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	128
Washington, US	67
Brussels, BE	57
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	54
RBINS-Scientific Heritagelocation not on record	35
Natick, US	29
Paris, FR	24
Western Australian Museumlocation not on record	11
Stockholm, SE	8
KAUMMlocation not on record	7
CASlocation not on record	5
	5
Frankfurt am Main	5
Museums Victorialocation not on record	4
Helsinki, FI	3
Los Angeles, US	3
Cambridge, US	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Honolulu, US	1
National Museums of Kenyalocation not on record	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

21 institutions · 451 of 684 vouchered records shown · 7 without an institution code

09Environmental DNA8 detections

Where the DNA of Actaeodes tomentosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)