Acsala anomala

Benjamin, 1935 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Acsala

At a glance

Occurrence records178

Data sources7

Biological traits0

DNA specimens11

eDNA detections11

Sources7 archives

Databases and archives Acsala anomala's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility178 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF178 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Acsala is a monotypic lichen moth genus in the monotypic tribe Acsalina of the family Erebidae. Its only species, Acsala anomala, can be found in the US state of Alaska. Both the genus and species were first described by Foster H. Benjamin in 1935.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acsala anomala has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

39Tvariable

61Amostly conserved

74Tmostly conserved

103Cvariable

145Tmostly conserved

181Tvariable

212Tvariable

214Amostly conserved

217Amostly conserved

218Gmostly conserved

223Avariable

232Cvariable

278Tmostly conserved

290Amostly conserved

291Cvariable

295Gvariable

298Amostly conserved

318Cmostly conserved

359Amostly conserved

376Tmostly conserved

418Tvariable

424Tmostly conserved

463Tmostly conserved

474Amostly conserved

477Gmostly conserved

506Gmostly conserved

536Cmostly conserved

538Amostly conserved

544Tmostly conserved

550Amostly conserved

551Cmostly conserved

556Tmostly conserved

557Tvariable

574Cmostly conserved

616Cmostly conserved

620Gmostly conserved

AACATTATATTTTATTTTTGGAATCTGAGCTGGAATAATAGGAACCTCATTAAGATTATTAATTCGAGCTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes8

BIN1

Most divergent pair3.6%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agylla collitoidessame family7.9%Lascoria niveasame family8.1%Feltia tricosasame order8.2%Feltia subgothicasame order8.4%Schinia volupiasame order8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type178 records

Wild obs. + sensor14

Museum / vouchered164

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1≤10 km 2

5 georeferenced · 9 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤1 km 129≤10 km 15>10 km 1

145 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KWPlocation not on record	132
University of Alberta Museums (UAM)location not on record	9
Edmonton, CA	9
Provo, US	3
Colorado State Universitylocation not on record	2
Mississippi State, US	1

6 institutions · 156 of 164 vouchered records shown · 8 without an institution code

09Environmental DNA11 detections

Where the DNA of Acsala anomala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

rocky slope

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.00 °C -6.80–13.6

Seasonal swing summer↔winter36.7 °C

Max temp (day)12.5 °C -3.00–17.4

Min temp (night)4.20 °C -10.6–9.40

Precipitation74.0 mm/mo 49.4–101

Air humidity59.7 % 57.0–65.4

Moisture balance-25.6 mm/mo -40.8–11.4

Vapour deficit464 Pa 222–652

Wind speed2.90 m/s 2.50–8.90

Cloud cover53.7 % 42.8–60.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)