Acruroperla atra

(Šámal, 1921) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Plecoptera/Austroperlidae/Acruroperla

At a glance

Occurrence records207

Data sources7

Biological traits0

DNA specimens7

eDNA detections6

Sources7 archives

Databases and archives Acruroperla atra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF207 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Acruroperla atra est une espèce d'insectes plécoptères de la famille des Austroperlidae, la seule du genre Acruroperla.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acruroperla atra has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes3

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)3.0%

Haplotypes1

BINs2

Where individuals differ — all 23 variable positions, in barcode order

40Tvariable

59Tvariable

76Avariable

100Avariable

103Tvariable

145Gvariable

160Gvariable

169Tvariable

271Cvariable

322Avariable

331Avariable

352Cvariable

500Cvariable

502Avariable

538Cvariable

547Avariable

553Avariable

586Cvariable

616Cvariable

619Gvariable

631Avariable

637Cvariable

643Gvariable

AACACTATACTTTATTTTTGGGGCATGATCAGGCATGGTTGGAACCGCTCTTAGTTTATTAATTCGTGCTGAATTAGGTCAACCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plumiperla diversasame order16.3%Taeniopteryx parvulasame order17.3%Alloperla petasatasame order17.8%Taeniopteryx metequisame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type207 records

Wild obs. + sensor54

Museum / vouchered76

Other77

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 30≤1 km 1≤10 km 2>10 km 2

35 georeferenced · 19 without coordinates

Open the mapobservation + sensor54

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 49>10 km 18

67 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	63
Museums Victorialocation not on record	5
Sydney, AU	5
The University of Melbournelocation not on record	1

4 institutions · 74 of 76 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Acruroperla atra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

stream

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter11.4 °C

Max temp (day)15.6 °C

Min temp (night)5.20 °C

Precipitation119 mm/mo

Air humidity60.1 %

Moisture balance1.00 mm/mo

Vapour deficit497 Pa

Wind speed5.50 m/s

Cloud cover25.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)