Acruliopsis tumidula

(Mäklin, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Acruliopsis

At a glance

Occurrence records15

Data sources5

Biological traits0

DNA specimens7

eDNA detections4

Sources5 archives

Databases and archives Acruliopsis tumidula's data was compiled from.

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acruliopsis tumidula has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P307 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)5.5%

Haplotypes1

BIN1

Where individuals differ — all 25 variable positions, in barcode order

5Cvariable

40Tvariable

43Avariable

70Tvariable

85Tvariable

91Avariable

103Cvariable

106Cvariable

124Cvariable

133Tvariable

139Avariable

145Cvariable

163Cvariable

175Avariable

184Tvariable

190Avariable

202Cvariable

214Gvariable

217Avariable

220Cvariable

250Cvariable

263Tvariable

265Avariable

284Cvariable

301Cvariable

AACTCTATACTTTATTTTTGGGGCATGAGCTGGTATAGTTGGAACATCTTTAAGAATTTTAATTCGTGCTGAATTAGGTAATCCTGGTTC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor3

Museum / vouchered12

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 7>10 km 1

8 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	7
Helsinki, FI	1
University of Alaska Museumlocation not on record	1
Canadian Forest Service, Laurentian Forestry Centrelocation not on record	1

4 institutions · 10 of 12 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Acruliopsis tumidula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

old growth Hemlock, Devil's Club, fernsthinned secondary growth under bryophytes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 5.90–8.60

Seasonal swing summer↔winter13.0 °C

Max temp (day)10.8 °C 9.20–12.8

Min temp (night)4.10 °C 2.70–6.10

Precipitation213 mm/mo 184–492

Air humidity66.5 % 60.1–70.3

Moisture balance129 mm/mo 99.1–412

Vapour deficit326 Pa 309–415

Wind speed6.60 m/s 4.90–7.20

Cloud cover47.4 % 38.4–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)