Acrulia inflata

(Gyllenhal, 1813) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Acrulia

At a glance

Occurrence records2 707

Data sources6

Biological traits2

DNA specimens8

eDNA detections8

Sources6 archives

Databases and archives Acrulia inflata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 707 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 707 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acrulia inflata is a species of beetle belonging to the family Staphylinidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)omnivore

Feeding guild (larval)omnivore

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrulia inflata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

451Tmostly conserved

492Gmostly conserved

514Tmostly conserved

TACCTTATATTTTATTTTTGGTGCCTGATCTGGAATAGTTGGAACTTCCCTTAGTATATTAATTCGTGCAGAACTTGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oxypoda alternanssame family11.6%Tachinus fimetariussame family12.0%Cyclotrachelus incisussame order13.1%Quedius ripariussame family13.8%Charhyphus picipennissame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 707 records

Wild obs. + sensor1 500

Museum / vouchered1 124

Fossil8

Other75

Range

Area of Occupancy AOO4 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 012≤1 km 292≤10 km 118>10 km 4

1 426 georeferenced · 74 without coordinates

Open the mapobservation + sensor1 500

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 600≤1 km 272≤10 km 172>10 km 30

1 074 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence1 124

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NMBU:MINAlocation not on record	243
SLU Artdatabankenlocation not on record	192
Trondheim, NO	138
Helsinki, FI	57
Olocation not on record	46
NHMOlocation not on record	36
Kuopio, FI	35
Provincia di Livornolocation not on record	28
NTNU-VMlocation not on record	25
Jyväskylä, FI	19
Tromsø, NO	18
Metsähallituslocation not on record	18
LSMlocation not on record	12
Muzeum Górnośląskie w Bytomiulocation not on record	10
Salzburg, AT	9
IFR-DNFlocation not on record	7
Copenhagen, DK	6
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	6
BioFokuslocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	5
Norwegian University of Life Sciences (NMBU)location not on record	5
ZSMlocation not on record	4
Oulu, FI	4
Tartu, EE	4
NCMGlocation not on record	3
Tallinn, EE	2
Philadelphia, US	2
NMOKlocation not on record	2
Tilburg, NL	2
ZMAAlocation not on record	2
neflocation not on record	2
TMPMlocation not on record	1
Uniwersytet Wrocławskilocation not on record	1
Rovaniemi, FI	1
CBDClocation not on record	1
MZLUlocation not on record	1

36 institutions · 952 of 1 124 vouchered records shown · 172 without an institution code

09Environmental DNA8 detections

Where the DNA of Acrulia inflata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

puronotkoaus rotfaulem Mulm einer liegenden alten Fic…Laubwaldin einer FlugkÃ¶derfalle an einer toten Jung…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 4.60–15.3

Seasonal swing summer↔winter18.1 °C

Max temp (day)16.9 °C 7.80–19.4

Min temp (night)8.60 °C 1.60–11.5

Precipitation66.8 mm/mo 59.0–87.8

Air humidity62.4 % 58.5–66.7

Moisture balance-0.8 mm/mo -52.2–27.6

Vapour deficit562 Pa 375–700

Wind speed4.00 m/s 3.30–5.40

Cloud cover40.9 % 33.8–63.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrulia inflata

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type2 707 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 707 records