Acrotona sylvicola

(Kraatz, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Acrotona

At a glance

Occurrence records478

Data sources5

Biological traits2

DNA specimens7

eDNA detections7

Sources5 archives

Databases and archives Acrotona sylvicola's data was compiled from.

GBIFGlobal Biodiversity Information Facility478 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF478 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)saprophagous

Feeding guild (larval)saprophagous

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrotona sylvicola has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

143Amostly conserved

197Tmostly conserved

200Gmostly conserved

226Cmostly conserved

229Amostly conserved

262Gvariable

380Gmostly conserved

440Amostly conserved

455Gmostly conserved

538Amostly conserved

556Amostly conserved

562Amostly conserved

568Tmostly conserved

577Gmostly conserved

634Tmostly conserved

AACCTTATATTTTGTATTTGGGACTTGAGCAGGCATAGTAGGGACCTCTTTAAGATTGCTGATTCGAGCAGAACTAGGAAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes3

BIN1

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrotona parenssame genus13.5%Acrotona parvulasame genus14.0%Aleochara moestasame family14.6%Cypha discoideasame family15.5%Euryusa sinuatasame family15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type478 records

Wild obs. + sensor286

Museum / vouchered187

Cultivated / captive5

Range

Area of Occupancy AOO1 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 244≤1 km 30≤10 km 8

282 georeferenced · 4 without coordinates

Open the mapobservation + sensor286

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 58≤1 km 71≤10 km 32>10 km 9

170 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence187

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	54
Helsinki, FI	34
Kuopio, FI	20
Tilburg, NL	9
Metsähallituslocation not on record	8
NHMOlocation not on record	7
CBDClocation not on record	5
NTNU-VMlocation not on record	4
ZSMlocation not on record	4
Institute of Plant and Animal Ecology (IPAE)location not on record	4
Tallinn, EE	3
Oulu, FI	3
LSMlocation not on record	3
Trondheim, NO	2
Tartu, EE	2
NMBU:MINAlocation not on record	2
ZMAAlocation not on record	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Olocation not on record	1
IFR-DNFlocation not on record	1
BioFokuslocation not on record	1
neflocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

23 institutions · 172 of 187 vouchered records shown · 15 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Acrotona sylvicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 1.60–16.2

Seasonal swing summer↔winter16.0 °C

Max temp (day)14.7 °C 4.10–20.2

Min temp (night)8.90 °C -0.8–11.7

Precipitation75.0 mm/mo 47.0–78.2

Air humidity61.9 % 59.3–69.1

Moisture balance-31.0 mm/mo

Vapour deficit517 Pa 255–755

Wind speed4.30 m/s

Cloud cover35.8 % 32.7–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)