Acrotaphus wiltii

(Cresson, 1870) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Acrotaphus

At a glance

Occurrence records832

Data sources7

Biological traits0

DNA specimens12

eDNA detections7

Sources7 archives

Databases and archives Acrotaphus wiltii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility832 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF832 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acrotaphus wiltii is a species of ichneumon wasp in the family Ichneumonidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrotaphus wiltii has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes3

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 2 variable positions, in barcode order

628Amostly conserved

631Gmostly conserved

AGTATTATATTTTATTTTTGGTATATGATCTGGAATAATTGGATCATCAATAAGAATTATTATTCGAATAGAATTAGGAAATCCAGGATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolichomitus terebranssame family9.4%Megaetaira madidasame family9.4%Zaglyptus simonissame family9.6%Diplazon laetatoriussame family10.2%Pion fortipessame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D2EF1-alpha

animal barcodemarker

08Occurrence & distribution

Record type832 records

Wild obs. + sensor815

Museum / vouchered17

Range

Area of Occupancy AOO2 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 503≤1 km 113≤10 km 24>10 km 66

706 georeferenced · 109 without coordinates

Open the mapobservation + sensor815

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Essig Museum of Entomologylocation not on record	2
CUlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1
ANSP, MV, FSCA, V, R, EMEC, MD, MNCN, ZMUTlocation not on record	1
University of Central Floridalocation not on record	1

8 institutions · 15 of 17 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Acrotaphus wiltii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 7.20–20.6

Seasonal swing summer↔winter27.9 °C

Max temp (day)20.6 °C 12.2–26.1

Min temp (night)13.5 °C 3.30–16.2

Precipitation93.7 mm/mo 51.9–119

Air humidity59.7 % 56.7–61.1

Moisture balance-6.20 mm/mo -43.5–18.1

Vapour deficit749 Pa 463–1,001

Wind speed2.80 m/s 2.30–4.30

Cloud cover44.5 % 38.1–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)