Acrossus luridus

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Acrossus

At a glance

Occurrence records3 003

Data sources6

Biological traits0

DNA specimens11

eDNA detections11

Sources6 archives

Databases and archives Acrossus luridus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 003 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 003 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT2n = 20

01Narrative

Acrossus luridus ou Aphodius luridus est une espèce d'insectes de l'ordre des coléoptères, de la famille des Scarabaeidae, de genre Acrossus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrossus luridus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections11

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

80Amostly conserved

88Avariable

124Tvariable

166Amostly conserved

197Tmostly conserved

217Avariable

226Cmostly conserved

271Avariable

311Amostly conserved

316Avariable

346Cmostly conserved

454Amostly conserved

499Amostly conserved

502Amostly conserved

511Amostly conserved

542Tmostly conserved

550Amostly conserved

619Avariable

628Gvariable

TACTCTTTACTTTCTATTTGGCAGTTGAGCCGGAATAGTTGGTACTTCATTGAGACTTCTAATTCGAGCAGAACTAGGAAACCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes6

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tetraclipeoides denticulatussame family12.9%Xylostiba bosnicasame order13.7%Trichonotulus scrofasame family13.8%Acrossus depressussame genus13.8%Laccobius obscuratussame order14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Acrossus luridus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type3 003 records

Wild obs. + sensor1 398

Museum / vouchered1 557

Cultivated / captive9

Other39

Origin

Native223

Range

Area of Occupancy AOO4 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 521≤1 km 167≤10 km 417>10 km 15

1 120 georeferenced · 278 without coordinates

Open the mapobservation + sensor1 398

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 55≤1 km 100≤10 km 528>10 km 15

698 georeferenced · 859 without coordinates

Open the institutions mapphysical evidence1 557

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	798
Geneva, CH	55
Natural History Museum Rotterdamlocation not on record	54
SLU Artdatabankenlocation not on record	52
Bern, CH	48
Paro, BT	46
Helsinki, FI	38
UGRlocation not on record	36
Zürich, CH	35
Fribourg, CH	32
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	26
Tartu, EE	24
Sion, CH	16
NCMGlocation not on record	15
NMOKlocation not on record	12
Musee d'Histoire Naturallelocation not on record	11
Dhaka, BD	11
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	9
Ugentlocation not on record	9
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
Museum zu Allerheiligen Schaffhausenlocation not on record	5
Frauenfeld, CH	5
CBDClocation not on record	4
Espace pour la vielocation not on record	4
South Kensington, GB	3
WULS-DFPElocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Naturama Aargaulocation not on record	2
Naturmuseum Solothurnlocation not on record	2
Naturalis Biodiversity Centerlocation not on record	2
Salzburg, AT	1

31 institutions · 1 366 of 1 557 vouchered records shown · 191 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Acrossus luridus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.90 °C 8.50–12.3

Seasonal swing summer↔winter16.6 °C

Max temp (day)12.4 °C 12.1–16.5

Min temp (night)5.20 °C 4.00–7.60

Precipitation51.3 mm/mo 44.9–75.0

Air humidity60.7 % 59.0–60.9

Moisture balance-25.4 mm/mo -28.1–-14.4

Vapour deficit470 Pa 449–610

Wind speed3.00 m/s 2.30–3.20

Cloud cover41.1 % 35.9–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrossus luridus

At a glance

Sources6 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 003 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 003 records