Acropteroxys gracilis

(Newman, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Erotylidae/Acropteroxys

At a glance

Occurrence records511

Data sources7

Biological traits0

DNA specimens12

eDNA detections9

Sources7 archives

Databases and archives Acropteroxys gracilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility511 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF511 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acropteroxys gracilis, the slender lizard beetle, is a species of Lizard Beetle in the family Erotylidae. It is found in Central America and North America, including into Canada. With a body length range of 6-12mm, it is narrower and shorter than its relative A. lecontei,A review of the North American Languriidae. Vaurie P. 1948. Bull. AMNH 92: 119-156. the only other currently described species within this genus. It is reported to feed upon Ambrosia plant species such as the Common Ragweed.Majka, Christopher & Migneault, Richard & Webster, Reginald. (2010). Acropteroxys gracilis (Newman): the first reports of a lizard beetle (Coleoptera: Erotylidae: Languriinae) in the Maritime Provinces of Canada. Entomol. Soc. 6. 28-29. Members of this plant genus are serious agricultural pests and so this insect species has been investigated for potential use as a Biocontrol Agent. However, A. gracilis is considered an economic pest due to its activity boring into the stems of Trifolium pratense (Red Clover), Medicago sativa (Alfalfa) and Melilotus spp. (Sweet Clover) as well as a number of other plants in the Asteraceae, Poaceae and Urticaceae families.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acropteroxys gracilis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

4Cmostly conserved

40Amostly conserved

85Tmostly conserved

91Gmostly conserved

160Amostly conserved

181Gmostly conserved

217Amostly conserved

232Cvariable

238Cmostly conserved

268Tvariable

271Cmostly conserved

343Amostly conserved

400Amostly conserved

550Amostly conserved

653Tmostly conserved

AACCCTTTATTTTATTTTTGGAGCTTGGGCAGGAATAATAGGAACTTCCTTAAGTTTATTGATTCGTGCAGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.63%

Haplotypes4

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phlebotomus majorsame order16.1%Rhizophagus aeneussame order16.9%Rhinosimus viridiaeneussame order17.2%Agylla collitoidessame order17.2%Culama australissame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type511 records

Wild obs. + sensor378

Museum / vouchered133

Range

Area of Occupancy AOO1 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 177≤1 km 73≤10 km 16>10 km 47

313 georeferenced · 65 without coordinates

Open the mapobservation + sensor378

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 6≤1 km 28≤10 km 34>10 km 16

84 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lubbock, US	46
Lexington, US	19
University of Guelphlocation not on record	17
Wuzhou, CN	14
University Park, US	13
OSUClocation not on record	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
MAJClocation not on record	2
US	2
Ciudad de México, MX	1
AHABlocation not on record	1
CUlocation not on record	1
New Haven, US	1
Espace pour la vielocation not on record	1
Cornell University Insect Collectionlocation not on record	1
University of Alabamalocation not on record	1

18 institutions · 130 of 133 vouchered records shown · 3 without an institution code

09Environmental DNA9 detections

Where the DNA of Acropteroxys gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

WetlandMixed habitatForest14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 13.2–19.0

Seasonal swing summer↔winter26.2 °C

Max temp (day)21.6 °C 18.9–23.3

Min temp (night)11.6 °C 8.00–15.8

Precipitation86.4 mm/mo 81.5–90.0

Air humidity56.2 % 55.1–58.0

Moisture balance-48.8 mm/mo -61.6–-37.7

Vapour deficit807 Pa 681–932

Wind speed3.30 m/s 2.70–4.00

Cloud cover44.3 % 40.8–46.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)