Acropora subulata

(Dana, 1846) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Scleractinia/Acroporidae/Acropora

At a glance

Occurrence records1 548

Data sources8

Biological traits4

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Acropora subulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility743 records↗

OBISOcean Biodiversity Information System805 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 548 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Acropora subulata est une espèce de coraux appartenant à la famille des Acroporidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max25 m

Depth min3 m

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acropora subulata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 602 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BINs0

ATGAAAAGTTTATATGTAGTTCGTTGGGGGTTTTCTACTAATCATAAAGATATTGGTACGTTATATTTAGTCTTTGGGATTGGGGCAGGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_081188 ↗ · 12 protein · 2 tRNA · 2 rRNA

ND5ND1ND2ND6ATP6ND4COX3COX2ND4LND3ATP8COX1rrn16rrn12

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 548 records

Wild obs. + sensor975

Museum / vouchered525

Other48

Range

Area of Occupancy AOO1 516 km²

Depth

0–200 m sunlit128

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 56.5 m · 128 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 464≤1 km 63≤10 km 16>10 km 22

565 georeferenced · 410 without coordinates

Open the mapobservation + sensor975

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 2≤1 km 267>10 km 8

277 georeferenced · 248 without coordinates

Open the institutions mapphysical evidence525

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	230
Western Australian Museumlocation not on record	21
CASlocation not on record	3
National Institute for Environmental Studieslocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Sydney, AU	2
University of the South Pacificlocation not on record	1

7 institutions · 261 of 525 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Acropora subulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acropora subulata

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type1 548 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 548 records