Acropora prolifera

(Lamarck, 1816) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Scleractinia/Acroporidae/Acropora

At a glance

Occurrence records413

Data sources10

Biological traits4

DNA specimens25

eDNA detections25

Sources10 archives

Databases and archives Acropora prolifera's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility278 records↗

OBISOcean Biodiversity Information System135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS413 records

Environmental DNA1 datasets · 5 countries25 detections

DNA & barcodingBOLD25 specimens

01Narrative

Acropora prolifera, the fused staghorn coral, is a branching, colonial, stony coral found in shallow parts of the Caribbean Sea, the Bahamas and southern Florida.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max30 m

Depth min1 m

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acropora prolifera has left across the world's sequence archives.

At a glance

DNA specimens25

Marker genes1

eDNA detections25

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 602 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.01%

Haplotypes2

BINs0

Most divergent pair0.06%

ATGAAAAGTTTATATGTAGTTCGTTGGGGGTTTTCTACTAATCATAAAGATATTGGTACGTTATATTTAGTCTTTGGGATTGGGGCAGGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type413 records

Wild obs. + sensor308

Museum / vouchered105

Origin

Native2

Range

Area of Occupancy AOO480 km²

Depth

0–200 m sunlit104

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 30 m · 104 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 56≤1 km 22≤10 km 14>10 km 6

98 georeferenced · 210 without coordinates

Open the mapobservation + sensor308

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 7

8 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	9
Washington, US	9
New Haven, US	6
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	3
UM-RSMASlocation not on record	2
Texas Cooperative Wildlife Collectionlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Tapachula, MX	1
The University of the West Indies, Trinidad and Tobagolocation not on record	1

10 institutions · 35 of 105 vouchered records shown · 27 without an institution code

09Environmental DNA25 detections

Where the DNA of Acropora prolifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 25.7–27.3

Seasonal swing summer↔winter2.70 °C

Max temp (day)27.6 °C 26.7–28.3

Min temp (night)26.1 °C 24.7–26.3

Precipitation156 mm/mo 76.5–288

Air humidity63.0 % 62.4–64.1

Moisture balance128 mm/mo

Vapour deficit1,299 Pa 1,209–1,324

Wind speed6.10 m/s

Cloud cover30.3 % 20.0–35.3

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)