Acropolitis hedista

(Turner, 1916) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acropolitis

At a glance

Occurrence records53

Data sources6

Biological traits0

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Acropolitis hedista's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF53 records

DNA & barcodingBOLD4 specimens

01Narrative

Acropolitis hedista is a species of moth of the family Tortricidae. It is found in Australia, where it has been recorded from Queensland. The wingspan is about 20 mm. The forewings are whitish, the costa barred with fuscous. There is a basal patch crossed by lines of greenish-ochreous. The hindwings are grey.New Australian Lepidoptera of the Family Tortricidae

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acropolitis hedista has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 5 variable positions, in barcode order

235Tmostly conserved

266Tmostly conserved

442Tmostly conserved

500Cmostly conserved

604Tvariable

TACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGTACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGTAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sciaphila debilianasame family6.7%Dichelia cosmopissame family7.3%Aphelia peramplanasame family7.6%Aphelia albocilianasame family7.8%Acropolitis magnanasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor41

Museum / vouchered12

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 15≤1 km 19≤10 km 3

37 georeferenced · 4 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4

2 institutions · 9 of 12 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)