Acroperus harpae

(Baird, 1834) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Branchiopoda/Diplostraca/Chydoridae/Acroperus

At a glance

Occurrence records6 639

Data sources7

Biological traits0

DNA specimens19

eDNA detections22

Sources7 archives

Databases and archives Acroperus harpae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 594 records↗

OBISOcean Biodiversity Information System45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS6 639 records

Environmental DNA2 datasets · 5 countries22 detections

DNA & barcodingBOLD19 specimens

01Narrative

Acroperus harpae is een watervlooiensoort uit de familie van de Chydoridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1834 door Baird.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroperus harpae has left across the world's sequence archives.

At a glance

DNA specimens19

BINs4

Marker genes1

eDNA detections22

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 83 variable positions, in barcode order

10Tmostly conserved

13Cmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Gmostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

37Gmostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

47Gmostly conserved

48Cmostly conserved

50Cmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

55Tvariable

56Tmostly conserved

58Amostly conserved

59Cmostly conserved

61Gmostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Gmostly conserved

69Tmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Cmostly conserved

81Amostly conserved

82Gmostly conserved

84Cmostly conserved

85Cmostly conserved

86Gmostly conserved

88Tmostly conserved

90Gmostly conserved

91Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Gmostly conserved

112Tvariable

121Cvariable

122Avariable

133Cvariable

172Tmostly conserved

187Cvariable

205Tvariable

346Cvariable

358Gvariable

361Cvariable

386Cmostly conserved

445Tmostly conserved

485Cvariable

529Gvariable

601Cvariable

607Gvariable

622Tvariable

625Tvariable

628Gvariable

AACTCTTTATTTCATTTTTGGTATTTGGGCAGGTATGGTTGGTACTGCTCTTAGTTTACTGATTCGGGTTGAATTAGGACAGGCCGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes6

BIN1

Most divergent pair2.7%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 639 records

Wild obs. + sensor4 942

Museum / vouchered1 619

Cultivated / captive53

Other25

Origin

Native263

Range

Area of Occupancy AOO8 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 3 178≤1 km 54≤10 km 30>10 km 1

3 263 georeferenced · 1 679 without coordinates

Open the mapobservation + sensor4 942

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 1 316≤1 km 107≤10 km 19>10 km 2

1 444 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence1 619

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 53 records without

Open the mapnot free-living53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	1 012
Institute of Ecology of the Volga river basin of Russian Academy of Sciences \| IEVB RASlocation not on record	50
Brussels, BE	44
Victoria, CA	35
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	17
Tempe, US	14
IB FRC Komi SC UB RASlocation not on record	11
Frankfurt am Main	10
RBINS-Scientific Heritagelocation not on record	8
Stockholm, SE	7
Museum für Naturkunde Berlin (Zoological Collections)location not on record	7
Cambridge, US	3
University of Guelphlocation not on record	3
South Kensington, GB	3
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
Sydney, AU	2
Tapachula, MX	2
Helsinki, FI	1
BioFokuslocation not on record	1
University of Oslo (UiO)location not on record	1
Bonn, DE	1
Tlalnepantla, MX	1
Toronto, CA	1

23 institutions · 1 236 of 1 619 vouchered records shown · 337 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA22 detections

Where the DNA of Acroperus harpae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map5 countries0

Lake - Nearshore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH4.80

Conductivity239 µS/cm

Organic carbon5.36 %

Water content24.4 %

Phosphorus32.0 mg/kg

Clay32.1 %

Sand42.5 %

Depth0 m

SoilTenosols

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 7.00–16.5

Seasonal swing summer↔winter29.2 °C

Max temp (day)20.7 °C 9.00–21.5

Min temp (night)11.6 °C 4.40–13.0

Precipitation93.3 mm/mo 82.5–113

Air humidity59.5 % 58.7–62.5

Moisture balance-32.4 mm/mo -42.2–25.9

Vapour deficit730 Pa 396–766

Wind speed2.90 m/s 2.50–3.50

Cloud cover41.2 % 40.7–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acroperus harpae

At a glance

Sources7 archives

At a glance

Record type6 639 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type6 639 records