Acronicta rubricoma

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records3 552

Data sources7

Biological traits0

DNA specimens29

eDNA detections29

Sources7 archives

Databases and archives Acronicta rubricoma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 552 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 552 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD29 specimens

01Narrative

Acronicta rubricoma, the ruddy dagger moth, is a moth of the family Noctuidae. It is found from southern Ontario and New York to central Florida, west to Texas and east Kansas. The wingspan is 38–44 mm. Adults are on wing from April to October depending on the location. There are two generations per year. The larvae feed on elm, hackberry and sumac.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta rubricoma has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

22Amostly conserved

211Gmostly conserved

220Tmostly conserved

235Cmostly conserved

352Cmostly conserved

451Gmostly conserved

532Cmostly conserved

628Avariable

631Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGGATGGTTGGTACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes7

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta americanasame genus7.1%Ectopatria deloptissame family7.3%Ectopatria horologasame family7.4%Acronicta totasame genus7.4%Ectopatria contrastasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 552 records

Wild obs. + sensor3 309

Museum / vouchered243

Range

Area of Occupancy AOO6 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 2 044≤1 km 388≤10 km 141>10 km 255

2 828 georeferenced · 481 without coordinates

Open the mapobservation + sensor3 309

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 4≤1 km 39≤10 km 90>10 km 4

137 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	59
King Saud Universitylocation not on record	51
East Lansing, US	48
New Haven, US	22
Colorado State Universitylocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Chicago, US	4
Natural History Museum Rotterdamlocation not on record	3
UNHClocation not on record	2
St. Paul, US	2
Philadelphia, US	1
University of Guelphlocation not on record	1
Washington, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Toronto, CA	1
UDlocation not on record	1
Saint John, CA	1

18 institutions · 226 of 243 vouchered records shown · 17 without an institution code

09Environmental DNA29 detections

Where the DNA of Acronicta rubricoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

ForestUrbanWetlandGrasslandMixed Habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 15.2–25.4

Seasonal swing summer↔winter25.7 °C

Max temp (day)24.2 °C 21.6–30.7

Min temp (night)19.9 °C 10.6–23.1

Precipitation94.8 mm/mo 79.6–140

Air humidity58.0 % 54.6–58.3

Moisture balance-97.2 mm/mo -101–-24.8

Vapour deficit1,086 Pa 794–1,405

Wind speed5.60 m/s 3.80–6.10

Cloud cover39.2 % 30.9–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta rubricoma

At a glance

Sources7 archives

At a glance

Record type3 552 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 552 records