Acronicta retardata

Walker, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records1 183

Data sources7

Biological traits0

DNA specimens55

eDNA detections55

Sources7 archives

Databases and archives Acronicta retardata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 183 records

Environmental DNA1 datasets · 2 countries55 detections

DNA & barcodingBOLD55 specimens

01Narrative

Acronicta retardata, the retarded dagger moth, is a moth of the family Noctuidae. It is found from Nova Scotia to Florida, west to Texas, north to Manitoba. Larva The wingspan is 25–32 mm. Adults are on wing from April to August depending on the location. There are multiple generations per year. The larvae feed on the leaves of red maple and sugar maple.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta retardata has left across the world's sequence archives.

At a glance

DNA specimens55

BINs3

Marker genes1

eDNA detections55

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus55 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

136Tvariable

160Avariable

217Avariable

223Amostly conserved

238Cvariable

274Tvariable

313Tmostly conserved

415Tvariable

466Gmostly conserved

487Tvariable

565Gvariable

580Tvariable

598Avariable

631Amostly conserved

658Tvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes26

BINs3

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta impressasame genus6.5%Acronicta auricomasame genus6.8%Acronicta totasame genus6.8%Acronicta rumicissame genus7.0%Ectopatria deloptissame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 183 records

Wild obs. + sensor885

Museum / vouchered298

Range

Area of Occupancy AOO3 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 436≤1 km 132≤10 km 63>10 km 102

733 georeferenced · 152 without coordinates

Open the mapobservation + sensor885

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 5≤1 km 31≤10 km 120>10 km 9

165 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence298

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	68
East Lansing, US	48
New Haven, US	47
St. Paul, US	23
University of Alberta Museums (UAM)location not on record	16
Cornell University Insect Collectionlocation not on record	13
CUlocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
King Saud Universitylocation not on record	4
Decorah, US	2
Natural History Museum of Utahlocation not on record	2
OSUClocation not on record	2
SOVTlocation not on record	2
Cambridge, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Saint John, CA	1
Chicago, US	1
Toronto, CA	1
UDlocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Champaign, US	1

22 institutions · 262 of 298 vouchered records shown · 36 without an institution code

09Environmental DNA55 detections

Where the DNA of Acronicta retardata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map2 countries0

ForestMixed HabitatTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 15.1–24.1

Seasonal swing summer↔winter21.6 °C

Max temp (day)23.4 °C 18.1–29.3

Min temp (night)15.0 °C 9.20–19.5

Precipitation109 mm/mo 79.4–156

Air humidity59.6 % 54.6–64.2

Moisture balance-28.3 mm/mo -77.3–34.5

Vapour deficit849 Pa 659–1,225

Wind speed3.00 m/s 1.90–4.10

Cloud cover38.6 % 27.2–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta retardata

At a glance

Sources7 archives

At a glance

Record type1 183 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 183 records