Acronicta pruinosa

(Guenée, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records183

Data sources7

Biological traits0

DNA specimens10

eDNA detections3

Sources7 archives

Databases and archives Acronicta pruinosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF183 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD10 specimens

01Narrative

Acronicta pruinosa is a moth of the family Noctuidae. It is found in Sri Lanka, the Himalaya, east to Japan and Taiwan south to Myanmar and Peninsular Malaysia, Borneo, Java and New Guinea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta pruinosa has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

50Tmostly conserved

103Tmostly conserved

118Cvariable

124Tmostly conserved

139Cvariable

160Amostly conserved

163Avariable

229Amostly conserved

268Tmostly conserved

316Amostly conserved

340Cmostly conserved

364Avariable

370Avariable

373Amostly conserved

397Cvariable

412Gmostly conserved

415Amostly conserved

418Tmostly conserved

427Tmostly conserved

439Tmostly conserved

460Cmostly conserved

463Cmostly conserved

478Cmostly conserved

499Cvariable

514Avariable

520Avariable

553Amostly conserved

595Cvariable

601Cvariable

641Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes3

BINs3

Most divergent pair3.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Resapamea hedenisame family8.7%Bryophila tephrocharissame family8.7%Ectopatria loxonephrasame family8.8%Pseudorthodes virgulasame family9.1%Lophoterges hoerhammerisame family9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type183 records

Wild obs. + sensor115

Museum / vouchered68

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 12≤1 km 14≤10 km 4>10 km 3

33 georeferenced · 82 without coordinates

Open the mapobservation + sensor115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	19
tesrilocation not on record	19
ZSMlocation not on record	6
Bavarian State Collection of Zoologylocation not on record	6
Helsinki, FI	5
Tartu, EE	3
FACTlocation not on record	3
Taiwan Forestry Research Institutelocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Paris, FR	1
Kawasaki Shi Tama Ku, JP	1

11 institutions · 68 of 68 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Acronicta pruinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 19.4–25.4

Seasonal swing summer↔winter1.20 °C

Max temp (day)27.7 °C 23.3–29.1

Min temp (night)20.9 °C 15.6–22.1

Precipitation263 mm/mo 167–354

Air humidity68.3 % 65.0–70.3

Moisture balance139 mm/mo 28.6–225

Vapour deficit959 Pa 789–969

Wind speed1.20 m/s 0.9–1.50

Cloud cover52.2 % 29.4–66.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)