Acronicta major

Bremer, 1864 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records556

Data sources7

Biological traits0

DNA specimens35

eDNA detections29

Sources7 archives

Databases and archives Acronicta major's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility556 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF556 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD35 specimens

01Narrative

Acronicta major is a moth of the family Noctuidae. It is found in the Korean Peninsula, China to Tibet, Japan, the Russian Far East (Primorye, Khabarovsk, Amur region, Sakhalin, southern Kuriles), southern Siberia (Altai), northern India and Nepal.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta major has left across the world's sequence archives.

At a glance

DNA specimens35

BINs5

Marker genes1

eDNA detections29

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 99 variable positions, in barcode order

3Cmostly conserved

19Cmostly conserved

30Amostly conserved

39Amostly conserved

41Cmostly conserved

45Tmostly conserved

48Amostly conserved

54Amostly conserved

72Cmostly conserved

78Cmostly conserved

87Amostly conserved

120Amostly conserved

123Amostly conserved

150Amostly conserved

153Tvariable

160Amostly conserved

162Cmostly conserved

166Tmostly conserved

172Tmostly conserved

180Cmostly conserved

183Tmostly conserved

189Amostly conserved

192Amostly conserved

195Tmostly conserved

198Amostly conserved

210Tmostly conserved

219Tmostly conserved

225Tmostly conserved

226Cmostly conserved

228Cmostly conserved

234Amostly conserved

237Amostly conserved

247Tmostly conserved

249Amostly conserved

258Amostly conserved

264Tmostly conserved

297Tmostly conserved

300Cmostly conserved

306Tmostly conserved

309Tmostly conserved

318Tmostly conserved

324Tmostly conserved

330Amostly conserved

342Tmostly conserved

345Cmostly conserved

346Cmostly conserved

357Tmostly conserved

363Tmostly conserved

372Tmostly conserved

375Amostly conserved

378Cmostly conserved

384Amostly conserved

388Cmostly conserved

393Gvariable

399Tmostly conserved

420Cvariable

423Tmostly conserved

429Amostly conserved

430Tmostly conserved

432Amostly conserved

436Amostly conserved

437Amostly conserved

438Tmostly conserved

439Tmostly conserved

444Amostly conserved

450Tmostly conserved

466Amostly conserved

468Tmostly conserved

474Amostly conserved

477Tmostly conserved

480Amostly conserved

483Cmostly conserved

486Tmostly conserved

492Tmostly conserved

493Tmostly conserved

496Cmostly conserved

498Amostly conserved

507Cvariable

513Tmostly conserved

528Tmostly conserved

538Cmostly conserved

540Tmostly conserved

546Amostly conserved

549Tmostly conserved

552Tmostly conserved

556Tmostly conserved

558Amostly conserved

564Amostly conserved

567Cvariable

570Cmostly conserved

573Cmostly conserved

579Amostly conserved

582Tmostly conserved

585Amostly conserved

588Gmostly conserved

591Amostly conserved

597Amostly conserved

601Tmostly conserved

618Tmostly conserved

GGCACCTCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATCTATAACACTATTGTAACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes4

BINs5

Most divergent pair3.4%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta gigasasame genus5.8%Ceromacra tymbersame order7.6%Acronicta atristrigatussame genus7.6%Xenopseustis poecilastissame family8.1%Phlogophora wollastonisame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_062172 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type556 records

Wild obs. + sensor360

Museum / vouchered196

Range

Area of Occupancy AOO1 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 37≤1 km 13≤10 km 16>10 km 7

73 georeferenced · 287 without coordinates

Open the mapobservation + sensor360

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 18≤1 km 2≤10 km 1

21 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence196

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gifu prefectural Museumlocation not on record	65
Iwate Prefectural Museumlocation not on record	25
JP	24
Hiwa Museum of Natural Historylocation not on record	18
Sagamihara, JP	11
KIRMlocation not on record	10
NSMKlocation not on record	10
KOMlocation not on record	8
Chiba, JP	6
HUNMlocation not on record	4
Bando, JP	4
Toyota city nature sanctuarylocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Toyama, JP	1
Gyeryonsan Natural History Museumlocation not on record	1
Philadelphia, US	1
New Haven, US	1
RCMlocation not on record	1
Shiojiri City Museum of Natural Historylocation not on record	1

19 institutions · 196 of 196 vouchered records shown

09Environmental DNA29 detections

Where the DNA of Acronicta major was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 18.6–22.5

Seasonal swing summer↔winter30.3 °C

Max temp (day)26.1 °C 22.3–26.1

Min temp (night)17.9 °C 14.6–17.9

Precipitation166 mm/mo 157–166

Air humidity61.2 % 61.2–66.3

Moisture balance28.1 mm/mo 28.1–40.4

Vapour deficit1,054 Pa 744–1,054

Wind speed2.10 m/s 1.80–2.10

Cloud cover38.1 % 38.1–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)