Acronicta insularis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records4 363

Data sources6

Biological traits0

DNA specimens69

eDNA detections72

Sources6 archives

Databases and archives Acronicta insularis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility4 363 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 363 records

Environmental DNA1 datasets · 3 countries72 detections

DNA & barcodingBOLD69 specimens

01Narrative

Acronicta insularis, the cattail caterpillar (when referring to the larva) or Henry's marsh moth (when referring to the adult), is a moth of the family Noctuidae. The species was first described by Gottlieb August Wilhelm Herrich-Schäffer in 1868. It is found from coast to coast throughout the United States and southern Canada (Ontario, Quebec, New Brunswick, Nova Scotia, British Columbia, Alberta, Saskatchewan and Manitoba). The wingspan is 35–40 mm. Adults are on wing from April to September. The larvae feed on Typha and Polygonum species, as well as various grasses and sedges, poplar and willow. Acronicta insularis was formerly called Simyra insularis. In 2015, the genus Simyra, along with Oxicesta and Eogena, were moved to Acronicta based on phylogenetic analysis. The MONA or Hodges number for Acronicta insularis is 9280. Marsh Dagger (Acronicta insularis)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta insularis has left across the world's sequence archives.

At a glance

DNA specimens69

BINs1

Marker genes1

eDNA detections72

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

103Tvariable

169Tvariable

283Tmostly conserved

307Gmostly conserved

556Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCACTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes15

BIN1

Most divergent pair2.6%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Simyra albovenosasame family4.1%Acronicta rumicissame genus5.0%Acronicta menyanthidissame genus5.6%Simyra nervosasame family5.9%Acronicta dollisame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 363 records

Wild obs. + sensor4 165

Museum / vouchered198

Range

Area of Occupancy AOO10 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 2 351≤1 km 549≤10 km 226>10 km 305

3 431 georeferenced · 734 without coordinates

Open the mapobservation + sensor4 165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 14≤1 km 51≤10 km 68>10 km 5

138 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	117
Colorado State Universitylocation not on record	16
Cornell University Insect Collectionlocation not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
North Carolina State University Insect Museumlocation not on record	5
Decorah, US	3
SOVTlocation not on record	2

8 institutions · 166 of 198 vouchered records shown · 32 without an institution code

09Environmental DNA72 detections

Where the DNA of Acronicta insularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map3 countries0

MarshTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 12.9–27.1

Seasonal swing summer↔winter18.3 °C

Max temp (day)27.8 °C 18.7–33.0

Min temp (night)18.1 °C 7.90–23.2

Precipitation94.8 mm/mo 10.8–238

Air humidity58.0 % 48.3–61.6

Moisture balance-35.6 mm/mo -135–73.2

Vapour deficit1,086 Pa 689–1,667

Wind speed3.00 m/s 2.10–4.10

Cloud cover32.8 % 14.8–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta insularis

At a glance

Sources6 archives

At a glance

Record type4 363 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 363 records