Acromyrmex subterraneus

(Forel, 1893) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Acromyrmex

At a glance

Occurrence records171

Data sources9

Biological traits0

DNA specimens8

eDNA detections4

Sources9 archives

Databases and archives Acromyrmex subterraneus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility171 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF171 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈318 Mbp

01Narrative

Acromyrmex subterraneus is a species of leaf-cutter ant, a New World ant of the subfamily Myrmicinae of the genus Acromyrmex. This species is from one of the two genera of advanced attines (fungus-growing ants) within the tribe Attini.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acromyrmex subterraneus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

13Cmostly conserved

24Cmostly conserved

28Amostly conserved

43Tmostly conserved

49Cmostly conserved

55Tmostly conserved

58Amostly conserved

59Tmostly conserved

68Tmostly conserved

79Gmostly conserved

87Gmostly conserved

94Tmostly conserved

100Tmostly conserved

103Cmostly conserved

110Amostly conserved

115Cmostly conserved

127Amostly conserved

139Cmostly conserved

181Gmostly conserved

202Tmostly conserved

229Gmostly conserved

238Cmostly conserved

262Gmostly conserved

265Cvariable

274Amostly conserved

277Cmostly conserved

286Tmostly conserved

301Cmostly conserved

305Tmostly conserved

317Amostly conserved

322Cmostly conserved

328Gmostly conserved

334Tmostly conserved

346Cmostly conserved

370Gmostly conserved

376Amostly conserved

379Cmostly conserved

386Cmostly conserved

406Cmostly conserved

424Tmostly conserved

433Cmostly conserved

458Amostly conserved

463Cmostly conserved

505Tmostly conserved

517Tmostly conserved

536Cmostly conserved

541Tmostly conserved

553Cmostly conserved

565Cmostly conserved

613Tmostly conserved

622Gvariable

625Amostly conserved

628Gmostly conserved

631Amostly conserved

AATCCTTTACTTCTTATTAGCTACCTGATCAGGTATAGTCGGTTCAGCCATAAGTATATTAATTCGCTTAGAACTAGGGTCTTGCGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes4

BINs2

Most divergent pair8.1%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acromyrmex heyerisame genus15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Acromyrmex subterraneus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈318 252 912 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acromyrmex subterraneus0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome records38–382n range38median38mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 383×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 191×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type171 records

Wild obs. + sensor5

Museum / vouchered166

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 10≤1 km 3≤10 km 23>10 km 1

37 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	111
Cornell University Insect Collectionlocation not on record	20
EL PASO, US	14
ASUlocation not on record	10
Bernardino Rivadavia Natural Sciences Museumlocation not on record	4
CEIOClocation not on record	3
Cambridge, US	1
Centre for Biodiversity Genomicslocation not on record	1
UNICAMPlocation not on record	1

9 institutions · 165 of 166 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Acromyrmex subterraneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 14.5–19.5

Seasonal swing summer↔winter8.60 °C

Max temp (day)24.2 °C 18.3–24.2

Min temp (night)15.2 °C 11.3–15.2

Precipitation278 mm/mo 278–425

Air humidity62.3 % 62.3–70.7

Moisture balance148 mm/mo 148–323

Vapour deficit851 Pa 501–851

Wind speed2.20 m/s 1.50–2.20

Cloud cover38.3 % 38.3–61.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)