Acrolophus mortipennella

Grote, 1872 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records682

Data sources7

Biological traits0

DNA specimens15

eDNA detections12

Sources7 archives

Databases and archives Acrolophus mortipennella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility682 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF682 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD15 specimens

01Narrative

Acrolophus mortipennella is a moth of the family Acrolophidae. It was described by Augustus Radcliffe Grote in 1872. It is found in North America, including Alabama, Florida, Illinois, Kentucky, Louisiana, Mississippi, Ohio, South Carolina and Texas. The wingspan is 23–30 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus mortipennella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs4

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 84 variable positions, in barcode order

38Gmostly conserved

46Cmostly conserved

82Tmostly conserved

85Tmostly conserved

97Cmostly conserved

118Tmostly conserved

133Amostly conserved

154Cmostly conserved

160Amostly conserved

163Amostly conserved

172Cmostly conserved

184Amostly conserved

187Tmostly conserved

193Cmostly conserved

202Tvariable

206Cmostly conserved

220Cmostly conserved

229Gmostly conserved

235Tmostly conserved

238Tmostly conserved

263Tmostly conserved

268Amostly conserved

277Tmostly conserved

287Tvariable

298Tmostly conserved

307Cmostly conserved

319Amostly conserved

322Tmostly conserved

325Tmostly conserved

334Tmostly conserved

340Tmostly conserved

343Tmostly conserved

346Tmostly conserved

347Tmostly conserved

349Amostly conserved

352Tvariable

358Tmostly conserved

361Tmostly conserved

367Tmostly conserved

370Avariable

373Amostly conserved

376Tmostly conserved

379Cmostly conserved

382Chighly variable

386Cmostly conserved

400Amostly conserved

415Amostly conserved

424Amostly conserved

428Tmostly conserved

448Cmostly conserved

463Tmostly conserved

469Amostly conserved

470Gmostly conserved

472Tmostly conserved

478Avariable

484Amostly conserved

490Tmostly conserved

493Amostly conserved

499Tmostly conserved

500Cmostly conserved

502Tmostly conserved

505Tmostly conserved

508Tmostly conserved

514Amostly conserved

520Cmostly conserved

529Cmostly conserved

530Tmostly conserved

532Amostly conserved

535Cmostly conserved

544Tvariable

547Tmostly conserved

571Tmostly conserved

574Tmostly conserved

575Amostly conserved

586Amostly conserved

589Tmostly conserved

595Tmostly conserved

607Cmostly conserved

616Cvariable

628Amostly conserved

634Tmostly conserved

646Tmostly conserved

652Tmostly conserved

658Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes6

BINs4

Most divergent pair9.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus hasbrouckisame genus7.4%Acrolophus comptussame genus8.2%Acrolophus variabilissame genus8.2%Acrolophus melanodoxasame genus8.8%Acrolophus hodgesisame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type682 records

Wild obs. + sensor565

Museum / vouchered117

Range

Area of Occupancy AOO1 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 274≤1 km 69≤10 km 18>10 km 93

454 georeferenced · 111 without coordinates

Open the mapobservation + sensor565

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 9≤10 km 24>10 km 15

48 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	51
Georgia Museum of Natural Historylocation not on record	22
Washington, US	11
Cornell University Insect Collectionlocation not on record	7
Denver, US	6
East Lansing, US	5
St. Paul, US	4
Champaign, US	4
New Haven, US	2
ASUlocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Natural History Museum of Utahlocation not on record	1

12 institutions · 117 of 117 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Acrolophus mortipennella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 21.1–25.2

Seasonal swing summer↔winter21.8 °C

Max temp (day)28.9 °C 27.8–30.5

Min temp (night)18.8 °C 14.5–20.8

Precipitation113 mm/mo 60.0–133

Air humidity57.7 % 55.7–61.1

Moisture balance-59.5 mm/mo -93.6–-53.5

Vapour deficit1,273 Pa 1,102–1,456

Wind speed4.00 m/s 2.70–4.40

Cloud cover33.0 % 29.3–33.7

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)