Acrolophus laticapitana

Walsingham, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records230

Data sources7

Biological traits0

DNA specimens74

eDNA detections66

Sources7 archives

Databases and archives Acrolophus laticapitana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility230 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF230 records

Environmental DNA1 datasets · 1 countries66 detections

DNA & barcodingBOLD74 specimens

01Narrative

Acrolophus laticapitana is a moth of the family Acrolophidae. It was described by Walsingham in 1884. It is found in North America, northern California to southern Arizona.mothphotographersgroup The length of the forewings 6.5–9.5 mm. Adults are slender and pale yellow to tan or whitish gray.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus laticapitana has left across the world's sequence archives.

At a glance

DNA specimens74

BINs12

Marker genes1

eDNA detections66

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

7Tvariable

10Tmostly conserved

20Avariable

37Amostly conserved

77Amostly conserved

78Avariable

79Tvariable

103Cvariable

124Cmostly conserved

127Tmostly conserved

136Tmostly conserved

139Tvariable

151Cmostly conserved

154Tvariable

163Gvariable

166Amostly conserved

169Tmostly conserved

181Amostly conserved

199Tmostly conserved

202Cvariable

203Cvariable

208Avariable

209Cvariable

217Cmostly conserved

265Cvariable

275Tmostly conserved

286Amostly conserved

287Amostly conserved

292Amostly conserved

295Tmostly conserved

301Tvariable

316Amostly conserved

319Avariable

325Amostly conserved

331Tmostly conserved

337Tmostly conserved

349Tvariable

355Tmostly conserved

358Tmostly conserved

361Tmostly conserved

365Amostly conserved

400Avariable

403Tmostly conserved

404Tmostly conserved

421Cmostly conserved

433Tmostly conserved

439Cvariable

445Tvariable

473Gmostly conserved

487Tvariable

490Tmostly conserved

511Avariable

520Tvariable

526Avariable

527Tvariable

529Amostly conserved

544Cvariable

545Tmostly conserved

553Cvariable

565Tmostly conserved

574Amostly conserved

575Tmostly conserved

580Cmostly conserved

586Cvariable

592Cvariable

601Tvariable

604Cmostly conserved

613Cvariable

616Tmostly conserved

625Avariable

631Cmostly conserved

637Tmostly conserved

643Tvariable

ATTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGTTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.6%

Haplotypes25

BINs12

Most divergent pair11.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus occidenssame genus5.2%Acrolophus heinrichisame genus7.7%Acrolophus cockerellisame genus8.3%Acrolophus prolatussame genus8.3%Acrolophus apricussame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type230 records

Wild obs. + sensor98

Museum / vouchered132

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 51≤1 km 12≤10 km 3>10 km 4

70 georeferenced · 28 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 12≤1 km 4≤10 km 50>10 km 50

116 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	92
Mississippi State, US	8
San Francisco, US	8
ASUlocation not on record	7
Denver, US	5
Cornell University Insect Collectionlocation not on record	2
Washington, US	2
Colorado State Universitylocation not on record	2
University of California, Davislocation not on record	1
Champaign, US	1
Essig Museum of Entomologylocation not on record	1
Mexico City, MX	1

12 institutions · 130 of 132 vouchered records shown · 2 without an institution code

09Environmental DNA66 detections

Where the DNA of Acrolophus laticapitana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.4. Temperate Forestfreshwater stream, and mediterranean climate…1. Forest & Woodland | 1.4. Temperate Forest3. Shrubland|3.8. Mediterranean-type Shrubby…Chaparral

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 16.7–24.6

Seasonal swing summer↔winter13.2 °C

Max temp (day)31.2 °C 24.0–32.7

Min temp (night)17.5 °C 11.7–18.4

Precipitation6.10 mm/mo 3.90–14.0

Air humidity52.6 % 38.5–60.8

Moisture balance-153 mm/mo -177–-128

Vapour deficit1,409 Pa 745–1,536

Wind speed1.80 m/s 1.30–2.80

Cloud cover12.2 % 11.7–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)