Acrolophus arcanella

Clemens, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records3 261

Data sources7

Biological traits0

DNA specimens41

eDNA detections3

Sources7 archives

Databases and archives Acrolophus arcanella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 261 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD41 specimens

01Narrative

Acrolophus arcanella (grass tubeworm moth) is a moth of the family Acrolophidae.Retrieved April 23, 2018. It is found in eastern North America.mothphotographersgroup The wingspan is about 25 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus arcanella has left across the world's sequence archives.

At a glance

DNA specimens41

BINs5

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Amostly conserved

166Avariable

206Tmostly conserved

220Cmostly conserved

241Amostly conserved

265Amostly conserved

274Cmostly conserved

352Cmostly conserved

364Cvariable

367Cvariable

397Tmostly conserved

400Gvariable

403Cmostly conserved

412Gvariable

439Amostly conserved

469Avariable

472Tmostly conserved

490Tmostly conserved

508Gvariable

565Cmostly conserved

625Amostly conserved

640Tmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGTATTTGATCCGGTATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCCGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes21

BINs5

Most divergent pair3.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus forbesisame genus8.1%Acrolophus hasbrouckisame genus8.4%Acrolophus filicornissame genus8.7%Acrolophus arizonellussame genus9.1%Acrolophus texanellasame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 261 records

Wild obs. + sensor2 911

Museum / vouchered350

Range

Area of Occupancy AOO6 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 476≤1 km 427≤10 km 76>10 km 398

2 377 georeferenced · 534 without coordinates

Open the mapobservation + sensor2 911

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 19≤1 km 56≤10 km 124>10 km 24

223 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence350

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	112
Mississippi State, US	84
New Haven, US	55
Cornell University Insect Collectionlocation not on record	28
Georgia Museum of Natural Historylocation not on record	21
Denver, US	19
Washington, US	16
King Saud Universitylocation not on record	4
Decorah, US	4
Philadelphia, US	2
ASUlocation not on record	2
St. Paul, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

13 institutions · 350 of 350 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Acrolophus arcanella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–26.0

Seasonal swing summer↔winter9.10 °C

Max temp (day)29.6 °C 29.6–31.0

Min temp (night)22.4 °C 22.2–22.4

Precipitation91.0 mm/mo 91.0–164

Air humidity59.4 % 59.4–62.0

Moisture balance-86.1 mm/mo -86.1–6.50

Vapour deficit1,344 Pa 1,279–1,344

Wind speed2.80 m/s 2.10–2.80

Cloud cover27.8 % 27.8–32.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrolophus arcanella

At a glance

Sources7 archives

At a glance

Record type3 261 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 261 records