Acrogonia nigriceps

(Signoret, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Acrogonia

At a glance

Occurrence records50

Data sources5

Biological traits0

DNA specimens10

eDNA detections7

Sources5 archives

Databases and archives Acrogonia nigriceps's data was compiled from.

GBIFGlobal Biodiversity Information Facility50 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF50 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrogonia nigriceps has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

562Gmostly conserved

CTTATATTTCATTTTTGGAATCTGATCAGGAATAGTAGGAATAATATTAAGAATAATTATTCGAGTTGAATTAGCTCAACCCGGTCCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Draeculacephala anguliferasame family12.5%Cuerna semibulbasame family12.7%Xyphon reticulatumsame family12.9%Cuerna costalissame family13.0%Draeculacephala crassicornissame family13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type50 records

Wild obs. + sensor17

Museum / vouchered33

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 3≤10 km 1>10 km 4

17 georeferenced

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 33 records without

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	29
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	4

2 institutions · 33 of 33 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Acrogonia nigriceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 24.7–25.5

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.2 °C 27.3–28.7

Min temp (night)22.4 °C 22.3–22.7

Precipitation356 mm/mo 303–463

Air humidity69.5 % 69.3–73.5

Moisture balance233 mm/mo 172–350

Vapour deficit977 Pa 840–995

Wind speed1.60 m/s 1.10–1.70

Cloud cover43.3 % 38.3–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)