Acrodactyla degener

(Haliday, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Acrodactyla

At a glance

Occurrence records179

Data sources5

Biological traits0

DNA specimens77

eDNA detections282

Sources5 archives

Databases and archives Acrodactyla degener's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility179 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI282 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF179 records

Environmental DNA5 datasets · 13 countries282 detections

DNA & barcodingBOLD77 specimens

01Narrative

Acrodactyla degener is een vliesvleugelig insect uit de familie van de gewone sluipwespen (Ichneumonidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1839 door Haliday.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrodactyla degener has left across the world's sequence archives.

At a glance

DNA specimens77

BINs4

Marker genes1

eDNA detections282

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

1Gmostly conserved

3Amostly conserved

30Avariable

66Tmostly conserved

78Tmostly conserved

81Cmostly conserved

84Amostly conserved

102Cmostly conserved

117Tmostly conserved

132Tmostly conserved

135Cmostly conserved

153Tmostly conserved

168Tmostly conserved

228Gmostly conserved

234Cmostly conserved

262Cmostly conserved

264Amostly conserved

276Tmostly conserved

315Amostly conserved

336Amostly conserved

339Cmostly conserved

342Cmostly conserved

372Tmostly conserved

384Tmostly conserved

393Cmostly conserved

396Cmostly conserved

414Tmostly conserved

426Cmostly conserved

432Gmostly conserved

457Amostly conserved

468Amostly conserved

474Cmostly conserved

482Amostly conserved

484Amostly conserved

526Amostly conserved

541Tmostly conserved

549Tmostly conserved

552Cmostly conserved

570Cmostly conserved

585Tmostly conserved

594Tmostly conserved

609Tmostly conserved

615Tmostly conserved

624Amostly conserved

627Tmostly conserved

630Tmostly conserved

645Tmostly conserved

GTATTATATTTTATTTTTGGTATATGATCAGGTATAATTGGATCTTCAATAAGAATTATTATTCGTATAGAACTTGGTAACCCAGGTTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes13

BINs4

Most divergent pair13.7%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scambus nigricanssame family10.5%Eruga albanoisame family10.7%Zonopimpla atricepssame family11.0%Megaetaira madidasame family11.0%Scambus signatussame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type179 records

Wild obs. + sensor84

Museum / vouchered95

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 32≤1 km 11≤10 km 36>10 km 1

80 georeferenced · 4 without coordinates

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 27≤1 km 4

31 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	21
Paris, FR	14
Metsähallituslocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
NTNU-VMlocation not on record	5
South Kensington, GB	5
SLU Artdatabankenlocation not on record	5
ZSMlocation not on record	4
NHMOlocation not on record	4
neflocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
MZLUlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

14 institutions · 77 of 95 vouchered records shown · 18 without an institution code

09Environmental DNA282 detections

Where the DNA of Acrodactyla degener was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found282

Studies independent surveys5

Countries13

Verifiable raw sequence linked197

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 282 detections have coordinates

Open the map13 countries0

1. Forest & Woodland|1.2 Subarctic Forest1. Forest & Woodland|1.4. Temperate ForestBog edge in alpine birch forestForestUrban1. Forest & Woodland | 1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.0–16.8

Seasonal swing summer↔winter18.8 °C

Max temp (day)16.2 °C 12.4–20.2

Min temp (night)10.1 °C 6.20–13.5

Precipitation78.6 mm/mo 58.4–134

Air humidity62.2 % 58.0–64.7

Moisture balance0.1 mm/mo -53.9–59.1

Vapour deficit600 Pa 467–754

Wind speed3.10 m/s 2.00–5.30

Cloud cover51.1 % 39.8–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 281 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)