Acroclita guanchana — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acroclita

At a glance

Occurrence records1

Data sources7

Biological traits0

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Acroclita guanchana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 records

DNA & barcodingBOLD4 specimens

01Narrative

Acroclita guanchana is a moth of the family Tortricidae. It is found on the Canary Islands and Madeira.Fauna Europaea The wingspan is 12–15 mm. The forewings are tawny reddish brown with some black scaling. The hindwings are grey with a slight rosy tinge. The larvae have been recorded feeding on the leaves of Hypericum grandifolium.lepiforum.de

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroclita guanchana has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 530 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

144Cmostly conserved

252Amostly conserved

276Cmostly conserved

426Cmostly conserved

471Gmostly conserved

663Avariable

669Tmostly conserved

672Cmostly conserved

681Cmostly conserved

975Tmostly conserved

999Tmostly conserved

1006Tmostly conserved

1011Amostly conserved

1044Gmostly conserved

1101Cmostly conserved

1113Amostly conserved

1164Amostly conserved

1179Amostly conserved

1197Avariable

1272Tmostly conserved

1302Tmostly conserved

1320Cmostly conserved

CGAAAATGACTTTATTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTTGGAACTTCCTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes3

BIN1

Most divergent pair1.0%

Europe

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type1 records

Wild obs. + sensor1

Range

Area of Occupancy AOO4 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.