Acrocercops transecta

Meyrick, 1931 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Acrocercops

At a glance

Occurrence records35

Data sources7

Biological traits0

DNA specimens239

eDNA detections239

Sources7 archives

Databases and archives Acrocercops transecta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI239 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics239 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 4 countries239 detections

DNA & barcodingBOLD239 specimens

01Narrative

Acrocercops transecta is a moth of the family Gracillariidae. It is known from Japan (Hokkaidō, Honshū, Kyūshū, Shikoku, Tusima), Korea, the Russian Far East and Taiwan.Global Taxonomic Database of Gracillariidae (Lepidoptera) The wingspan is 7.4–9.6 mm. The larvae feed on Lyonia ovalifolia, Carya aquatica, Carya myristiciformis, Carya ovata, Juglans ailanthifolia, Juglans cinerea, Juglans cordiformis, Juglans hindsii, Juglans illinoensis, Juglans mandschurica, Juglans nigra, Juglans regia, Juglans sieboldiana, Platycarya strobilacea and Pterocarya rhoifolia. They mine the leaves of their host plant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding239 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrocercops transecta has left across the world's sequence archives.

At a glance

DNA specimens239

BINs1

Marker genes3

eDNA detections239

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.90%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 13 variable positions, in barcode order

80Cmostly conserved

86Avariable

98Amostly conserved

158Avariable

212Gvariable

227Amostly conserved

311Cvariable

314Gmostly conserved

371Avariable

374Amostly conserved

399Tvariable

410Amostly conserved

545Amostly conserved

CACTTTATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCTTTAAGTCTTCTTATTCGTGCTGAATTAGGTAACCCTGGATCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xylorycta aphelessame order11.9%Crypsicharis entheticasame order12.2%Phyllonorycter obtusifoliellasame family12.5%Prorophora curvibasellasame order12.5%Hypomecis nessasame order12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type35 records

Wild obs. + sensor2

Museum / vouchered33

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Kushiro City Museumlocation not on record	8
Iwate Prefectural Museumlocation not on record	5
KIRMlocation not on record	3

3 institutions · 16 of 33 vouchered records shown · 1 without an institution code

09Environmental DNA239 detections

Where the DNA of Acrocercops transecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found239

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 239 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–10.8

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–13.3

Min temp (night)3.00 °C 3.00–6.50

Precipitation344 mm/mo 340–344

Air humidity64.9 % 64.9–65.0

Moisture balance263 mm/mo 252–263

Vapour deficit428 Pa 428–525

Wind speed2.90 m/s 1.80–2.90

Cloud cover44.6 % 44.6–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)