Acrocercops astericola

(Frey & Boll, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Acrocercops

At a glance

Occurrence records717

Data sources7

Biological traits0

DNA specimens544

eDNA detections542

Sources7 archives

Databases and archives Acrocercops astericola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility717 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI542 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics544 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF717 records

Environmental DNA1 datasets · 2 countries542 detections

DNA & barcodingBOLD544 specimens

01Narrative

Acrocercops astericola is a moth of the family Gracillariidae, known from Canada (Québec and Nova Scotia) and the United States (Pennsylvania, Kentucky, Maine, Michigan, Vermont, Massachusetts and New York). The hostplants for the species include Eurybia divaricata, Symphyotrichum cordifolium, Symphyotrichum lateriflorum, Symphyotrichum novi-belgii, and Inula germanica. The mine has the form of a flat upperside blotch mine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding544 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrocercops astericola has left across the world's sequence archives.

At a glance

DNA specimens544

BINs2

Marker genes1

eDNA detections542

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus504 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

200Amostly conserved

235Cmostly conserved

313Tmostly conserved

343Gmostly conserved

532Cmostly conserved

631Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTGGGAACTTCTTTAAGAATATTGATTCGAGTTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes19

BINs2

Most divergent pair6.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Latoia viridifasciasame order11.6%Tulsa umbripennissame order12.5%Lithostege pallescenssame order12.5%Strymon eurytulussame order12.6%Barsine roseororatussame order13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type717 records

Wild obs. + sensor294

Museum / vouchered423

Range

Area of Occupancy AOO1 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 146≤1 km 38≤10 km 6>10 km 13

203 georeferenced · 91 without coordinates

Open the mapobservation + sensor294

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 4≤1 km 3≤10 km 26>10 km 2

35 georeferenced · 388 without coordinates

Open the institutions mapphysical evidence423

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	155
East Lansing, US	27
University of Alberta Museums (UAM)location not on record	14
Washington, US	8
Centre for Biodiversity Genomicslocation not on record	7
UNHClocation not on record	7
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	4
Mississippi State, US	3
Biodiversity Institute of Ontariolocation not on record	2
St. Paul, US	2
Canadian Forest Service, Northern Forestry Centrelocation not on record	1
CUlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1

13 institutions · 232 of 423 vouchered records shown · 191 without an institution code

09Environmental DNA542 detections

Where the DNA of Acrocercops astericola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found542

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 542 detections have coordinates

Open the map2 countries0

Temperate mixed forestRiparian Zone4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodlandat UVL in old-growth aspen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 8.70–16.1

Seasonal swing summer↔winter25.0 °C

Max temp (day)16.1 °C 13.7–21.1

Min temp (night)6.40 °C 2.80–10.2

Precipitation63.1 mm/mo 38.0–119

Air humidity56.8 % 55.6–59.9

Moisture balance-62.0 mm/mo -67.0–-3.40

Vapour deficit591 Pa 497–786

Wind speed1.50 m/s 1.40–4.20

Cloud cover39.9 % 37.7–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 542 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)