Acrocercops albinatella

(Chambers, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Acrocercops

At a glance

Occurrence records103

Data sources7

Biological traits0

DNA specimens14

eDNA detections15

Sources7 archives

Databases and archives Acrocercops albinatella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF103 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD14 specimens

01Narrative

Acrocercops albinatella is a moth of the family Gracillariidae, known from Quebec and the United States (including Maryland, New York, Maine, Georgia, Florida, Missouri, Ohio, Kentucky and Texas). Adults are on wing in late June and early July in central Illinois.microleps.org The hostplants for the species include Quercus alba, Quercus laevis, Quercus obtusiloba, Quercus rubra, and Quercus stellata. They mine the leaves of their host plant. The mine starts as a long, winding, Nepticulid-like mine ending in a large, tentiform mine on the underside of the leaf.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrocercops albinatella has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

20Gmostly conserved

22Amostly conserved

220Amostly conserved

235Cmostly conserved

250Cmostly conserved

304Cmostly conserved

307Cmostly conserved

313Tmostly conserved

325Amostly conserved

334Tmostly conserved

337Amostly conserved

340Cmostly conserved

347Tmostly conserved

367Cmostly conserved

370Amostly conserved

400Tmostly conserved

409Cmostly conserved

412Cmostly conserved

433Gmostly conserved

533Cmostly conserved

542Cmostly conserved

628Amostly conserved

634Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTCTTAGTTTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes5

BINs2

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Machimia tentoriferellasame order9.7%Pycnarmon cribratasame order10.0%Bradina impressalissame order10.5%Synclera traducalissame order10.8%Arthroschista hilaralissame order10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor79

Museum / vouchered24

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 42≤1 km 18≤10 km 1>10 km 7

68 georeferenced · 11 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 3≤1 km 7>10 km 1

11 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	9
Washington, US	8
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Philadelphia, US	1
San Francisco, US	1
Smithsonian Institutionlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1

7 institutions · 23 of 24 vouchered records shown · 1 without an institution code

09Environmental DNA15 detections

Where the DNA of Acrocercops albinatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 21.0–27.1

Seasonal swing summer↔winter10.5 °C

Max temp (day)31.9 °C 25.8–31.9

Min temp (night)22.4 °C 16.7–22.9

Precipitation111 mm/mo 84.6–286

Air humidity60.9 % 57.6–61.6

Moisture balance31.0 mm/mo -67.9–132

Vapour deficit1,374 Pa 1,030–1,397

Wind speed2.30 m/s 1.50–3.40

Cloud cover33.0 % 30.1–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)