Acrida sulphuripennis

(Gerstaecker, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Acrida

At a glance

Occurrence records52

Data sources6

Biological traits0

DNA specimens19

eDNA detections19

Sources6 archives

Databases and archives Acrida sulphuripennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF52 records

Environmental DNA1 datasets · 3 countries19 detections

DNA & barcodingBOLD19 specimens

01Narrative

Acrida sulphuripennis is een rechtvleugelig insect uit de familie veldsprinkhanen (Acrididae). De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1869 door Gerstaecker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrida sulphuripennis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections19

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 72 variable positions, in barcode order

1Tmostly conserved

67Tmostly conserved

71Cmostly conserved

82Avariable

89Amostly conserved

133Cmostly conserved

319Tmostly conserved

370Amostly conserved

388Tmostly conserved

397Amostly conserved

533Tmostly conserved

554Cvariable

559Tmostly conserved

560Gmostly conserved

562Amostly conserved

563Gmostly conserved

564Cmostly conserved

566Amostly conserved

567Tmostly conserved

569Amostly conserved

570Cmostly conserved

571Amostly conserved

573Tmostly conserved

574Amostly conserved

575Tmostly conserved

577Amostly conserved

578Tmostly conserved

580Amostly conserved

582Cmostly conserved

583Tmostly conserved

584Gmostly conserved

585Amostly conserved

586Cmostly conserved

588Gmostly conserved

589Amostly conserved

592Tmostly conserved

595Amostly conserved

598Tmostly conserved

599Amostly conserved

600Cmostly conserved

601Amostly conserved

602Tmostly conserved

603Cmostly conserved

605Tmostly conserved

607Cmostly conserved

608Tmostly conserved

611Gmostly conserved

612Amostly conserved

613Tmostly conserved

614Cmostly conserved

616Amostly conserved

617Gmostly conserved

618Cmostly conserved

619Amostly conserved

620Gmostly conserved

622Amostly conserved

623Gmostly conserved

625Tmostly conserved

626Gmostly conserved

628Tmostly conserved

629Gmostly conserved

630Amostly conserved

631Cvariable

634Amostly conserved

636Tmostly conserved

637Cmostly conserved

639Tmostly conserved

640Amostly conserved

641Tmostly conserved

642Amostly conserved

643Cmostly conserved

650Tmostly conserved

TCTATACTTTATATTTGGTGCATGATCAGGAATAGTAGGAACATCAATAAGAATAATTATTCGTGCTGAACTAGGACAACCAGGATCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes3

BIN1

Most divergent pair1.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrida bicolorsame genus7.0%Acrida ungaricasame genus7.8%Acrida willemseisame genus8.3%Acrida cinereasame genus9.2%Oxya japonicasame family10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type52 records

Wild obs. + sensor27

Museum / vouchered25

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 12≤1 km 3≤10 km 2>10 km 1

18 georeferenced · 9 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 7

7 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	7
Muséum d'histoire naturelle de Marseillelocation not on record	7
Stockholm, SE	3
Durban Natural Science Museumlocation not on record	2

4 institutions · 19 of 25 vouchered records shown · 6 without an institution code

09Environmental DNA19 detections

Where the DNA of Acrida sulphuripennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

Thorn VeldKnob Thorn/MarulaÂ SavannahMopaneÂ Shrubveld2. Savanna | 2.1. Dry SavannaAlluvial PlainsSabie/Crocodile Thorn Thicket

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 19.1–25.9

Seasonal swing summer↔winter8.40 °C

Max temp (day)28.2 °C 24.5–30.7

Min temp (night)17.5 °C 13.2–20.8

Precipitation55.0 mm/mo 9.00–112

Air humidity56.4 % 54.1–60.0

Moisture balance-77.6 mm/mo -101–-32.5

Vapour deficit1,255 Pa 953–1,438

Wind speed2.90 m/s 2.40–3.70

Cloud cover37.0 % 13.5–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)