Acratodes suavata

Hulst, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Acratodes

At a glance

Occurrence records165

Data sources7

Biological traits0

DNA specimens5

eDNA detections12

Sources7 archives

Databases and archives Acratodes suavata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility165 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF165 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD5 specimens

01Narrative

Acratodes suavata is a species of geometrid moth in the family Geometridae. It is found in the Caribbean Sea and North America. The MONA or Hodges number for Acratodes suavata is 7148.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acratodes suavata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

229Avariable

AACTTTATATTTTATTTTTGGAATCTGAGCCGGTATAGTAGGTACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudasellodes fenestrariasame family7.9%Syneora cheleutasame family7.9%Chorodnodes rothisame family7.9%Syneora leucanthessame family7.9%Scopula acidaliasame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type165 records

Wild obs. + sensor146

Museum / vouchered19

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 59≤1 km 35≤10 km 4>10 km 5

103 georeferenced · 43 without coordinates

Open the mapobservation + sensor146

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Georgia Museum of Natural Historylocation not on record	1

3 institutions · 19 of 19 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Acratodes suavata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 24.7–28.2

Seasonal swing summer↔winter5.90 °C

Max temp (day)33.7 °C 30.0–33.7

Min temp (night)24.0 °C 20.6–24.2

Precipitation119 mm/mo 53.9–155

Air humidity60.0 % 58.1–60.4

Moisture balance-16.4 mm/mo -70.7–-8.40

Vapour deficit1,500 Pa 1,268–1,519

Wind speed1.70 m/s 1.60–3.40

Cloud cover26.4 % 25.8–28.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)