Acraga philetera

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Dalceridae/Acraga

At a glance

Occurrence records25

Data sources5

Biological traits0

DNA specimens44

eDNA detections50

Sources5 archives

Databases and archives Acraga philetera's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 3 countries50 detections

DNA & barcodingBOLD44 specimens

01Narrative

Acraga philetera is a moth in the family Dalceridae. It was described by Schaus in 1910.Dalceridae genus list It is found in Costa Rica.BOLD Systems The wingspan is about 22 mm. The body is orange and the forewings are orange, darkest on the inner margin. The hindwings are orange with the costal margin broadly whitish yellow. The underside is paler.XLIV.—New species of Heterocera from Costa Rica—II

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraga philetera has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes1

eDNA detections50

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

40Amostly conserved

88Gmostly conserved

100Amostly conserved

166Gvariable

202Tmostly conserved

205Tmostly conserved

268Gmostly conserved

271Tmostly conserved

274Gmostly conserved

343Tmostly conserved

367Cmostly conserved

469Cmostly conserved

493Gmostly conserved

514Avariable

562Avariable

565Gvariable

574Cmostly conserved

628Amostly conserved

640Cmostly conserved

646Cmostly conserved

GACTCTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes13

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraga goessame genus8.8%Pterospoda kunzeisame order10.6%Idaea nigrolineatasame order10.6%Glyphodes umbriasame order10.8%Dichogama prognealissame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Museum / vouchered25

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	10
Washington, US	8
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	2
University of Pennsylvanialocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

5 institutions · 22 of 25 vouchered records shown · 3 without an institution code

09Environmental DNA50 detections

Where the DNA of Acraga philetera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map3 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.0–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.0 °C 26.1–28.2

Min temp (night)21.8 °C 20.0–24.1

Precipitation370 mm/mo 58.6–478

Air humidity70.8 % 64.4–75.5

Moisture balance218 mm/mo -102–344

Vapour deficit924 Pa 714–1,051

Wind speed1.80 m/s 1.00–2.70

Cloud cover34.0 % 13.6–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)