Acraga ochracea

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Dalceridae/Acraga

At a glance

Occurrence records15

Data sources7

Biological traits0

DNA specimens14

eDNA detections20

Sources7 archives

Databases and archives Acraga ochracea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD14 specimens

01Narrative

Acraga ochracea is a moth in the family Dalceridae. It was described by Francis Walker in 1855. It is found in southern Brazil, Paraguay and northern Argentina. The habitat consists of tropical premontane moist, subtropical wet, subtropical moist, subtropical dry and warm temperate moist forests. The length of the forewings is 9–13 mm for males and 16–17 mm for females. Adults are orange, with the dorsal forewing darker than the hindwing. Adults are on wing year round., 1994: Systematics of the Neotropical moth family Dalceridae (Lepidoptera). Bulletin of the Museum of Comparative Zoology 153(4): 1–495. Full Article: [1]

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraga ochracea has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Amostly conserved

43Amostly conserved

49Avariable

106Cmostly conserved

115Tmostly conserved

124Tmostly conserved

163Amostly conserved

181Amostly conserved

220Cmostly conserved

235Tmostly conserved

271Cvariable

284Tmostly conserved

313Cmostly conserved

373Amostly conserved

400Tmostly conserved

403Cmostly conserved

421Tvariable

433Gvariable

451Tmostly conserved

544Amostly conserved

562Amostly conserved

646Cmostly conserved

652Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes6

BIN1

Most divergent pair1.8%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rhesala fusiformissame order7.9%Acraga concolorsame genus8.2%Acraga melindasame genus8.3%Synopsidia phasidariasame order8.7%Drastoma dardaniasame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor3

Museum / vouchered12

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corporación Centro de Investigación en Palma de Aceite - CENIPALMAlocation not on record	6
Washington, US	4
The University of the West Indies, Trinidad and Tobagolocation not on record	2

3 institutions · 12 of 12 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Acraga ochracea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 19.8–24.4

Seasonal swing summer↔winter5.80 °C

Max temp (day)26.5 °C 23.8–28.1

Min temp (night)19.7 °C 14.9–21.0

Precipitation143 mm/mo 95.8–190

Air humidity65.5 % 62.4–68.8

Moisture balance11.0 mm/mo -34.3–71.5

Vapour deficit954 Pa 748–1,060

Wind speed1.80 m/s 1.40–2.70

Cloud cover34.6 % 26.9–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)