Acraga hamata

Schaus, 1910 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Dalceridae/Acraga

At a glance

Occurrence records94

Data sources6

Biological traits0

DNA specimens32

eDNA detections31

Sources6 archives

Databases and archives Acraga hamata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 1 countries31 detections

DNA & barcodingBOLD32 specimens

01Narrative

Acraga hamata is a moth of the family Dalceridae. It is found in Costa Rica, Panama and possibly Colombia. The habitat consists of tropical premontane wet and rain forests at altitudes above 800 meters. The length of the forewings is 14–16 mm for males and 21 mm for females. The forewings are bright light yellow and the hindwings are yellow (lighter than the forewings) with a whitish costal margin. Adults are on wing from May to February., 1994: Systematics of the Neotropical moth family Dalceridae (Lepidoptera). Bulletin of the Museum of Comparative Zoology 153(4): 1-495. Full Article: [1]

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acraga hamata has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections31

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

7Gmostly conserved

79Amostly conserved

88Gmostly conserved

118Cmostly conserved

181Gmostly conserved

196Amostly conserved

197Cmostly conserved

238Amostly conserved

268Amostly conserved

278Tmostly conserved

292Tmostly conserved

373Amostly conserved

437Gmostly conserved

536Tmostly conserved

628Gmostly conserved

646Cmostly conserved

AACTTTGTATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes6

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acraga mooreisame genus7.9%Acraga coasame genus8.4%Lomographa anoxyssame order9.9%Xanthorhoe alticolatasame order9.9%Patania deficienssame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Museum / vouchered94

Range

Area of Occupancy AOO108 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 94 records without

Open the institutions mapphysical evidence94

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	81
University of Pennsylvanialocation not on record	1

2 institutions · 82 of 94 vouchered records shown · 12 without an institution code

09Environmental DNA31 detections

Where the DNA of Acraga hamata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 16.2–25.7

Seasonal swing summer↔winter2.50 °C

Max temp (day)26.2 °C 21.0–30.1

Min temp (night)21.1 °C 12.2–21.8

Precipitation205 mm/mo 32.0–423

Air humidity67.8 % 59.3–74.0

Moisture balance73.1 mm/mo -142–323

Vapour deficit939 Pa 550–1,304

Wind speed4.00 m/s 1.00–5.60

Cloud cover31.2 % 16.0–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)